ID: 1154322993

View in Genome Browser
Species Human (GRCh38)
Location 18:13369404-13369426
Sequence GCCTCAGTGGGCTGTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154322986_1154322993 -8 Left 1154322986 18:13369389-13369411 CCTGGGGGCCTGTTGGCCTCAGT 0: 1
1: 1
2: 6
3: 27
4: 198
Right 1154322993 18:13369404-13369426 GCCTCAGTGGGCTGTTGGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154322993 Original CRISPR GCCTCAGTGGGCTGTTGGGT GGG Intronic
900465824 1:2825040-2825062 GCCCCTCTGGGCTGATGGGTGGG + Intergenic
900630958 1:3634951-3634973 GCCTGAGCAGGCTGTTGGGGAGG - Intronic
901461659 1:9395626-9395648 GCCTCAGAGGGCTGTCTGGTAGG + Intergenic
901771928 1:11534971-11534993 GCCTCAGTGCGCTGCTGTGTGGG - Intronic
901781661 1:11598419-11598441 TCCTCAGAGGGCTGTGGGGAGGG + Intergenic
902030206 1:13416650-13416672 GCCCAAGTGGGCTGGTGGGGAGG + Intronic
902786153 1:18733943-18733965 ATCTCTGTGGGCTTTTGGGTTGG + Intronic
904011057 1:27390960-27390982 GCCTCATGGGGTTGTTGAGTGGG - Intergenic
904400097 1:30250562-30250584 GCCTCATGGGGCTGTTGGGAGGG + Intergenic
904510170 1:30998580-30998602 GCTGCAGTGAGCTGTGGGGTGGG + Intronic
905303572 1:37002331-37002353 GACTCAGCTGGTTGTTGGGTTGG - Intronic
905349077 1:37332029-37332051 GCCTCCGTGGGGTGTTAGGGAGG - Intergenic
905893795 1:41532630-41532652 GCCTCAGTGGCCATTTGGATGGG + Intronic
907274401 1:53309393-53309415 ACCTCAAAGGGCTGTTGGCTGGG - Intronic
909492687 1:76242851-76242873 TCATCAGTGGGCATTTGGGTTGG + Intronic
910392722 1:86761421-86761443 GCCTCTGTGTGGTCTTGGGTAGG - Intergenic
911400575 1:97369598-97369620 GCTTCAGAGGGTTGTTGGGAGGG + Intronic
911637389 1:100249940-100249962 TCCTTGGTTGGCTGTTGGGTGGG - Intergenic
912831078 1:112954942-112954964 ACCTCACTGGGCTGGTGGTTGGG + Intronic
915971137 1:160356083-160356105 GCCCCAGAGAGCTCTTGGGTGGG + Intronic
916019898 1:160782481-160782503 GCCCAACTGTGCTGTTGGGTAGG - Intergenic
918185460 1:182122868-182122890 ACCTCAGTGGGATTCTGGGTGGG + Intergenic
919219730 1:194611729-194611751 GCCTCATAGGGTTGTTGTGTGGG + Intergenic
922674825 1:227543705-227543727 GCATCAATGGGCTGTTGGCTTGG + Intergenic
1064848858 10:19687416-19687438 GGCTAAGTGGGTTGGTGGGTGGG - Intronic
1065918124 10:30368987-30369009 GCATCAGAGGGCTGTGGGGATGG - Intronic
1066083966 10:31959292-31959314 GCCTCAGTGAGGTGTGGGGTGGG + Intergenic
1066525514 10:36274878-36274900 GCCTCCCTTGGCTGTGGGGTGGG - Intergenic
1072995544 10:100240493-100240515 GCCTACTTGGGATGTTGGGTTGG + Intronic
1073059004 10:100722353-100722375 GCCTCAGTGGGCTACTGTGGAGG - Intergenic
1074299194 10:112218136-112218158 CCCTCAGTAGGCTGTTAGGAAGG - Intergenic
1075188866 10:120287693-120287715 GCTTCAGTGGGCTATTGGGAAGG + Intergenic
1077244698 11:1530850-1530872 GCATCTGTGGGCTGGTGGGTGGG - Intergenic
1077385361 11:2267204-2267226 ACCACAGGGGGCTGTTGGGTGGG - Intergenic
1077953843 11:6991472-6991494 GCCTGAGGGGGCTCTAGGGTAGG - Intergenic
1078648852 11:13168439-13168461 GCCACAGTGGGCTGCTGGACAGG - Intergenic
1079244414 11:18742448-18742470 TCCTCAGGGGGCAGTGGGGTGGG + Exonic
1083193039 11:61066307-61066329 GCCTCTGTTAGCTGTTGGGATGG - Intergenic
1083873344 11:65505897-65505919 GGCTGAGAGGGCTTTTGGGTGGG + Intergenic
1084185638 11:67469352-67469374 CCCTGAGCGGGCTGATGGGTGGG + Intergenic
1084444074 11:69193331-69193353 GCCCCATTTGGCTGGTGGGTGGG - Intergenic
1085055598 11:73401756-73401778 GCCTCGGTTGGCCTTTGGGTTGG + Intronic
1085508007 11:77071135-77071157 GCCTCGGTGGGCACTGGGGTGGG - Intronic
1089704705 11:120269544-120269566 GCCTGAGTTGCCTCTTGGGTGGG + Intronic
1091404635 12:201610-201632 GCCTCAGTGATGTGTGGGGTTGG + Intronic
1092232019 12:6781191-6781213 GCTTCAGTGGGTGGGTGGGTGGG + Intergenic
1093549279 12:20388119-20388141 GCCTTAGTGGTCGTTTGGGTTGG + Intronic
1094807399 12:34106822-34106844 GCATCAGTGGGCTGTTGTCTTGG - Intergenic
1096393341 12:51246792-51246814 GCCTCAGTGGGCTGTAAAATTGG + Exonic
1101477867 12:105067706-105067728 CCCTCCGTGTGCTCTTGGGTGGG - Intronic
1102307508 12:111816544-111816566 GCCTCAGTGGAATGCTGAGTTGG + Intergenic
1102308569 12:111825804-111825826 GCCTCAGTGGAATGCTGAGTTGG + Intergenic
1102574632 12:113848581-113848603 GTCTCAAGGGGCTTTTGGGTTGG + Intronic
1103557622 12:121775779-121775801 GCCTGAGAGGGCTGCTGGGAAGG - Exonic
1104752069 12:131246099-131246121 GCCTCCGTGGGCTGCTGGGGCGG - Intergenic
1104927553 12:132321598-132321620 GCCACAGTGGGCCCTGGGGTTGG - Intronic
1105335485 13:19463775-19463797 GCCTCAGTGGCCTGATGGTGAGG + Intronic
1107833187 13:44392488-44392510 GCCTCACTGGGGTCTTGGGGAGG + Intronic
1108253702 13:48590966-48590988 TCCTCAGTGGGATGTTGCTTTGG + Intergenic
1110289854 13:73792158-73792180 GACTCACTGGTATGTTGGGTTGG - Intronic
1111443035 13:88305135-88305157 GACTCTGTGGACTGTTGGGAAGG + Intergenic
1112002355 13:95222516-95222538 GCCCCAGAAGGCTGTGGGGTGGG + Intronic
1113460803 13:110480473-110480495 GCCTCTGTGGGCCGTGGGGCTGG + Intronic
1113672416 13:112183957-112183979 GACTCAGTGTGCGGCTGGGTTGG + Intergenic
1113928650 13:113954723-113954745 TGCTCAGTGGCTTGTTGGGTGGG - Intergenic
1116958191 14:50944641-50944663 GCCGCAGTGGGCTCGGGGGTGGG + Exonic
1117257355 14:53991957-53991979 GCATCACTGGGCTGTTGGCCTGG - Intergenic
1118883765 14:69850186-69850208 GCCTCATCGGGCTGTGGGCTGGG - Intergenic
1122402436 14:101475418-101475440 GCCTCAAAGGGCTGTTCTGTGGG - Intergenic
1122936081 14:104956915-104956937 GGCGCTGTGGGCTGTAGGGTGGG - Intronic
1123089911 14:105737904-105737926 GCCTCAGTGCCCTGAGGGGTGGG - Intergenic
1124237439 15:28002652-28002674 TCCTCAGCGGGCTGATGGGGTGG + Intronic
1124343472 15:28904921-28904943 CCCTCAGTGTGCTGGTGAGTGGG - Intronic
1124959394 15:34383382-34383404 GCATCAGAGGGCTGTGGGGGTGG - Intronic
1124976020 15:34529603-34529625 GCATCAGAGGGCTGTGGGGGTGG - Intronic
1126106950 15:45152886-45152908 GTGTCTGTGGGGTGTTGGGTAGG + Intronic
1127773249 15:62246966-62246988 GCATCAGAGGGCTGTGGGGATGG - Intergenic
1127774564 15:62254978-62255000 GCATCAGAGGGCTGTGGGGATGG - Intergenic
1128730282 15:70015990-70016012 GCATCAGTGTGCTGTTGTGCAGG - Intergenic
1129113943 15:73354466-73354488 ACTTCAGTCGGCTGTGGGGTGGG + Intronic
1129727525 15:77909193-77909215 GCCTCAGTTGGTTGCGGGGTGGG - Intergenic
1130064891 15:80595208-80595230 GAGTCAGTGGGCTGATGGGCTGG - Exonic
1130094998 15:80849335-80849357 GGCTCAGTGGGCAGTTGCATAGG - Intronic
1130878098 15:88031879-88031901 GTCTCAGTGGGTTGCAGGGTGGG - Intronic
1131282829 15:91034621-91034643 GCATCAGAGGGCTGTGGGGGTGG - Intergenic
1132116166 15:99138007-99138029 GCCTCAGTCTGCTGTTGTGCCGG + Exonic
1132210618 15:100019587-100019609 GCCTCAGTGGGCTGGAGCGCAGG - Intronic
1133563590 16:6971898-6971920 GCCTCAGTGGGGTGGTGAGATGG + Intronic
1136913929 16:34163671-34163693 GCCTCGGAGGGGTGTTGGGGAGG - Intergenic
1139437513 16:66944887-66944909 GGCTCAGTGGGGTGTTGGGGAGG - Exonic
1141928333 16:87183892-87183914 GTCTCAGTGCTCTGTTGGGCGGG - Intronic
1143618565 17:8068030-8068052 GCCTCGGTGGGCTGGTGGGTGGG + Intergenic
1144377331 17:14657377-14657399 GCATCAGTGGGTTCTTTGGTGGG + Intergenic
1145796996 17:27661261-27661283 GGCTCAGAGGGCTGCTGGGAAGG - Intergenic
1146278435 17:31529994-31530016 CCTTCACTGGGCTGCTGGGTGGG + Intronic
1146842109 17:36163460-36163482 GGCTCAGAGGGCTGCTGGGAAGG + Intergenic
1146854417 17:36251419-36251441 GGCTCAGAGGGCTGCTGGGAAGG + Intronic
1146870320 17:36375311-36375333 GGCTCAGAGGGCTGCTGGGAAGG + Intronic
1146877677 17:36426392-36426414 GGCTCAGAGGGCTGCTGGGAAGG + Intronic
1147073201 17:37975935-37975957 GGCTCAGAGGGCTGCTGGGAAGG + Intergenic
1147084723 17:38055473-38055495 GGCTCAGAGGGCTGCTGGGAAGG + Intronic
1147100670 17:38179439-38179461 GGCTCAGAGGGCTGCTGGGAAGG + Intergenic
1147236068 17:39058523-39058545 GCCTCAGTGGCCTCCTGTGTAGG + Intergenic
1148332191 17:46819522-46819544 GCCTCAGTGGGATTCTCGGTTGG + Intronic
1148850038 17:50550145-50550167 GCAGCAGGGGGCTGTGGGGTGGG + Intronic
1149381392 17:56097559-56097581 GCATCAGTGGTCTGTTAGGGTGG + Intergenic
1150083607 17:62262486-62262508 GGCTCAGAGGGCTGCTGGGAAGG + Intergenic
1152120333 17:78414517-78414539 GGCTCAGTGGGCAGCTGGGCAGG + Intronic
1154322993 18:13369404-13369426 GCCTCAGTGGGCTGTTGGGTGGG + Intronic
1155873849 18:31060538-31060560 GCATCACTGTGCTGTTGTGTGGG - Exonic
1160567813 18:79798072-79798094 GCCGCAGTGGGCGGTGGGGCGGG + Intergenic
1162453242 19:10767113-10767135 GGCTCAGTGGCTTGTTGGCTGGG + Intronic
1162475406 19:10896550-10896572 GCCCCAGTGGACTGGTGGCTTGG - Intronic
1163160558 19:15461556-15461578 GCCTCAGGGATCTGTGGGGTAGG + Exonic
1163404378 19:17113225-17113247 GCGTCAGTGGGCAGCAGGGTGGG + Intronic
1163698199 19:18774561-18774583 TCCTCTGGGGCCTGTTGGGTGGG + Intronic
1165890625 19:39110189-39110211 GCCTGGGTGGGGAGTTGGGTGGG + Exonic
1166095679 19:40537596-40537618 CCCTCATGGGGCTGTTGGGGAGG - Intronic
1166594620 19:44034588-44034610 GCCTCACTGGACTGCTGAGTTGG + Intergenic
1166658282 19:44627898-44627920 GACTCTCTGGGTTGTTGGGTTGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
926502682 2:13675222-13675244 GCTTCTGTGGGCTGCTTGGTTGG + Intergenic
927486965 2:23495268-23495290 GCCTCTGTGGGCTGTCAGGCAGG + Intronic
927853274 2:26513121-26513143 GAGTCAGTGGGCGGTGGGGTTGG + Intronic
928724879 2:34160897-34160919 TCCTCAGTAGGCTGATGGGCAGG + Intergenic
930682557 2:54272517-54272539 ACCTCAAAGGGCTGATGGGTTGG - Intronic
933938685 2:87227600-87227622 GCCCCAGAAGGCTGTAGGGTGGG - Intergenic
933976932 2:87519303-87519325 GCATCAGTGGCCTGTAGGGGTGG - Intergenic
934228237 2:90153318-90153340 GCATCAGTGGGCTGTAGCCTAGG - Intergenic
934717192 2:96550917-96550939 GCCTCAGGTGCCTGGTGGGTGGG - Intronic
936054800 2:109254402-109254424 TCCTCATTGGACTGTTGGGGAGG + Intronic
936316885 2:111431501-111431523 GCATCAGTGGCCTGTAGGGGTGG + Intergenic
936354450 2:111738173-111738195 GCCCCAGAAGGCTGTAGGGTGGG + Intergenic
938536332 2:132252575-132252597 GCCTCAGAGGAGTGTTGGGGAGG + Intronic
940240875 2:151562032-151562054 GTGTCAGTGGGCTGATGGGCAGG - Intronic
942072670 2:172329714-172329736 GCCCCAGTGGGCTGGATGGTGGG - Intergenic
944021117 2:195105726-195105748 TCCTCAGTTGGCTCTTGGCTTGG - Intergenic
948965488 2:241376482-241376504 GTGTCAGTGGGCTGGTGTGTAGG + Intronic
1168840058 20:904202-904224 CCCTCAGTGGCCTGTAGGGAGGG - Intronic
1168996942 20:2140370-2140392 GCCCCAGTGGGCCCTTGGGGAGG - Intronic
1171199510 20:23230089-23230111 GCATGACTGGGCTGCTGGGTGGG - Intergenic
1171767106 20:29296513-29296535 GCCTCAGAGGGGTGTTGGGGAGG + Intergenic
1171908841 20:30922242-30922264 GCCTCAGAGGGGTGTTGGGGAGG - Intergenic
1172027641 20:31960038-31960060 GGCTCAATGGGCTTTTGGGCTGG - Intergenic
1172180580 20:33001048-33001070 GCCACAGTGGGTTCTGGGGTGGG + Intronic
1172519395 20:35557264-35557286 GCGTCTGTGAGCTGTGGGGTGGG + Intronic
1172766685 20:37354872-37354894 TCCTCACCGGGCTGTTGGGAAGG + Intronic
1173485575 20:43438589-43438611 GCCTCAGAAGGCTGCTGGGTGGG - Intergenic
1175469873 20:59219904-59219926 GGTTCAGTGGGCAGGTGGGTGGG + Intronic
1175874255 20:62221968-62221990 GCCTCAGTGGGTATTTGGGGAGG - Intergenic
1178590146 21:33902721-33902743 ACCTGAGCGGGCTGTTGCGTGGG + Intronic
1180060820 21:45384019-45384041 GCCTCAATGGGCTGGCGGCTGGG - Intergenic
1180062763 21:45393976-45393998 GTCGCAGTCGGCTGTGGGGTCGG + Intergenic
1181585025 22:23848474-23848496 GCCTCAGCTGGTTGTGGGGTTGG + Intergenic
1182524330 22:30906164-30906186 GGCACAGTGGGCTGGTGGGTGGG - Intronic
1185092134 22:48781588-48781610 CCCACAGTGGGCAGGTGGGTCGG - Intronic
1185252604 22:49812931-49812953 GCCTCAGTCTGCGGTTGGGAGGG - Intronic
1185280111 22:49966340-49966362 GCCTCTGTGGGCTCCTAGGTGGG + Intergenic
950010795 3:9722342-9722364 GCCTCACTTGGCTGTAGAGTGGG - Intronic
950106927 3:10394354-10394376 ACCTCAGGGGGCTGTTGTGAGGG - Intronic
950259821 3:11535773-11535795 GCCCCAGAGGGCTCTTGGGAAGG - Intronic
951925870 3:27908244-27908266 GCAGTAGTGGGCTGGTGGGTGGG + Intergenic
953031672 3:39183911-39183933 GCCTCACTGGGCAGCTGGCTGGG + Exonic
953907493 3:46875699-46875721 GCATAAGTGGGATGGTGGGTGGG - Intronic
956903741 3:73744086-73744108 TCCTCACTGGACTGTGGGGTTGG + Intergenic
961206460 3:125086285-125086307 GGCTCTGTGGGCTGTGAGGTGGG - Intronic
961641402 3:128366853-128366875 AGCTCATGGGGCTGTTGGGTTGG + Intronic
961649778 3:128411527-128411549 TCCTCTGTGGGCTGATGGGTGGG + Intergenic
962938145 3:140100633-140100655 TCCTCAGTGGGCTGTGTGGGAGG - Intronic
963043816 3:141088047-141088069 TCCGCAGTGTGCTGTGGGGTGGG + Intronic
972461944 4:39312370-39312392 GAATCAGCGGCCTGTTGGGTAGG - Intronic
975737184 4:77392645-77392667 GCCTCAGTGGAATGCTGAGTTGG + Intronic
976166042 4:82256021-82256043 GGGTCAGTTGGCTGTTGGCTGGG - Intergenic
980494735 4:133575995-133576017 GCCTGAGTAGGTTGGTGGGTGGG - Intergenic
985062244 4:186091098-186091120 GACTGAGTCGGCTCTTGGGTGGG + Intergenic
985733644 5:1565196-1565218 GCCACAGGGCGATGTTGGGTGGG - Intergenic
995635469 5:114185412-114185434 GCCTCAGTGGGCAGGCTGGTTGG - Intergenic
996785299 5:127230658-127230680 GCCTCACTGTGCTGCTGGGAGGG - Intergenic
997074570 5:130657432-130657454 CCCTCACTCGGCTGTTGTGTTGG - Intergenic
997674588 5:135703338-135703360 GCCTCACTGGGCTGCCGTGTGGG - Intergenic
997776985 5:136618466-136618488 ACCTCAGAGGGCTGTTGGAGAGG - Intergenic
998821336 5:146060362-146060384 GGCTCAGTGGGGAGTTGGGGAGG - Intronic
998888956 5:146725972-146725994 GCATCAGTGGGCTGGTGTGCTGG + Intronic
999075527 5:148791917-148791939 GCCACAGTGGGGTGTGGGTTTGG - Intergenic
999698955 5:154210499-154210521 GCCTGAGTGGGCTGAGGGTTGGG - Intronic
1000053076 5:157578601-157578623 ACCACAGCGGGCTGTTGGGGAGG - Intergenic
1000128499 5:158271529-158271551 TCCTCACTGGGCTATTGTGTTGG - Intergenic
1000643647 5:163735321-163735343 ACCTCAGTGGGCAGGTTGGTTGG + Intergenic
1002309562 5:178306414-178306436 GCCTCTGTGGGCTGCAGGGAAGG + Intronic
1002322959 5:178386646-178386668 GTCTCAGTGAGCTGTGGGGGCGG - Intronic
1002889034 6:1317627-1317649 GCCGCAGTGGGCAGCTGGGTGGG + Intergenic
1002947861 6:1780014-1780036 GCCTGAGAGAGCTGTTGGGTGGG - Intronic
1003680173 6:8244955-8244977 GCCCCAGTGGACTGTGGGGAGGG + Intergenic
1004172266 6:13304640-13304662 GCCTCAGAAGGCAGTTGGCTTGG + Intronic
1004361522 6:14975386-14975408 GCCTGAGTGAGCTTATGGGTAGG + Intergenic
1005121127 6:22390155-22390177 GCCTCCCTTGGCTGTGGGGTGGG + Intergenic
1007040282 6:38715368-38715390 GCCTCAGTGGGCTGAGTGGTCGG + Exonic
1008056691 6:46952942-46952964 GCCTTAATGGGCAATTGGGTGGG + Intronic
1008647615 6:53531058-53531080 GCCTCACAGGGCTGCTGGGGAGG + Intronic
1011330993 6:86206368-86206390 GCCTCAGTGGAATGCTGAGTTGG + Intergenic
1015497670 6:133897763-133897785 GGCTCAGAGTGCTTTTGGGTTGG - Intergenic
1015928231 6:138331281-138331303 GACTCAGTGGGCAGTGGGATTGG - Intronic
1017250101 6:152271131-152271153 GTCTCTGTGGGCAGTTAGGTTGG - Intronic
1017759408 6:157556498-157556520 CCCTCACTGTGCTGTTTGGTAGG + Intronic
1019388239 7:770682-770704 TGCTCAGTGAGCTGTTGGGGAGG - Intronic
1019509714 7:1411828-1411850 GCCTCACAGGGCTGTTGTGAGGG - Intergenic
1020211772 7:6163421-6163443 TACACAGTGGGCTGTTGGGTTGG - Exonic
1020240730 7:6392979-6393001 TCCTCAGTGTGCGGGTGGGTCGG + Intronic
1020677327 7:11197533-11197555 ACCTCAGTGGGCAGCTGGTTGGG - Intergenic
1023965194 7:44960489-44960511 GCTTCTGGGGGCTTTTGGGTTGG + Intergenic
1024088774 7:45918810-45918832 ACCTCAGTGAGCTGTTTGGCAGG - Intronic
1024759787 7:52582141-52582163 TCATCAGTGGGCATTTGGGTTGG - Intergenic
1026015725 7:66669340-66669362 GCCTCTGGGGGCTGTGGGGTGGG - Intronic
1026952061 7:74354142-74354164 AGCTTAGTGGGCTGTTGGGAAGG - Intronic
1029744804 7:102510962-102510984 GACTCAGTGGGCTAGCGGGTGGG + Intronic
1029762796 7:102610124-102610146 GACTCAGTGGGCTAGCGGGTGGG + Intronic
1031937485 7:127750477-127750499 CCCTCAGTGGGGTTGTGGGTAGG + Intronic
1033347224 7:140534867-140534889 GCCCCAGTGGGAGGTTGGCTGGG + Intronic
1033606639 7:142932567-142932589 CCCTCAGGCAGCTGTTGGGTGGG + Intronic
1034490357 7:151390013-151390035 GCCTCAGTGCTCTGCTGGGCTGG - Intronic
1034940646 7:155228198-155228220 GCCACAGGGGGCTGTTGTCTTGG + Intergenic
1035102616 7:156414115-156414137 GCCTCAGTGGACCCTTGGATGGG - Intergenic
1035384020 7:158458533-158458555 ACATCATGGGGCTGTTGGGTGGG - Intronic
1036603811 8:10288484-10288506 GCCTCAGTTGCTTGTTGTGTTGG + Intronic
1036757999 8:11484153-11484175 GCCTCAGTGTTTTGTTTGGTTGG - Intergenic
1038494815 8:27993874-27993896 GCCTCAGGGGGTTGTTGAATAGG - Intergenic
1038525782 8:28271981-28272003 GTCTCAGTGGTCTTTTGGGTAGG - Intergenic
1038659235 8:29482476-29482498 ACCTCAGTGGGCTGTTTATTGGG + Intergenic
1039268247 8:35852142-35852164 TATTCAGTGGGATGTTGGGTGGG + Intergenic
1040335309 8:46413013-46413035 GACTCAGTGGGATGTTGGGCAGG + Intergenic
1040341912 8:46445386-46445408 GCCTCAGTGGGGTCATGTGTGGG - Intergenic
1040875000 8:52141815-52141837 GCCCCTGTGGGGTGGTGGGTGGG + Intronic
1043195465 8:77287244-77287266 GCACCAGTGGGCTGGTGTGTCGG - Intergenic
1043520105 8:81035537-81035559 GCTCCAGTGGACTGTGGGGTAGG + Intronic
1044542287 8:93421256-93421278 GCCTCAGTGGGTGGGTGGGTGGG - Intergenic
1048367509 8:133751177-133751199 GCCTCCTGGGGCTGTTGGGAGGG + Intergenic
1049470451 8:142773011-142773033 GTCTCAGTGGGGTGATGGGGAGG - Intronic
1049584262 8:143425683-143425705 CCCCCAGTGGGCAGTAGGGTGGG + Intronic
1049689983 8:143954092-143954114 GACTCGGGGGGCTGTGGGGTGGG - Intronic
1049755977 8:144311493-144311515 GCATCAGGGGGCTGTGGGGAAGG - Exonic
1050844199 9:10193358-10193380 GCCTCTGTGTGCGGTTGGGCTGG + Intronic
1051885068 9:21883904-21883926 GCCACAGGGGGCTGTTGTGAAGG + Intronic
1052029473 9:23611795-23611817 GGCTCAGGGGGATGTGGGGTTGG - Intergenic
1053054616 9:34987282-34987304 GCCTCAGGGGGTTGTTGAGAGGG - Intergenic
1053175285 9:35917920-35917942 TCCTTAGAGGGCTATTGGGTGGG + Intergenic
1055596051 9:77865179-77865201 GCCTCAGTGGCCTTTCAGGTAGG - Intronic
1056529779 9:87476984-87477006 GGCACAGTGGGAGGTTGGGTTGG - Intergenic
1057294010 9:93824968-93824990 GCTGCAGAGGGCTGTTGGGCAGG - Intergenic
1057962735 9:99472119-99472141 GCCTCACAGGGCTGTTGGGATGG - Intergenic
1059642755 9:116233862-116233884 GCCTCAGTGGTTGGTTGGGAGGG - Intronic
1059867075 9:118527261-118527283 GCCACAGAGGGCTGTTCTGTAGG - Intergenic
1060941603 9:127545903-127545925 GCCACTGTGGGCTGTGGGCTGGG - Intronic
1061014789 9:127975340-127975362 TCCTCAGTGGGCTTTTGATTTGG - Intronic
1061278204 9:129581644-129581666 GCCTCAGGGGTCTGTTAGGAAGG + Intergenic
1061495628 9:130972827-130972849 CCCTCAGTGGGCTGTGTGGCTGG - Intergenic
1061768878 9:132901761-132901783 TCCTCTGTGGGCTGGTGGCTAGG - Intronic
1062568322 9:137173028-137173050 GCCTCCGTTGGCTGTGGGGCAGG - Intergenic
1185504134 X:619485-619507 GCCTCGGTGGGTGGGTGGGTGGG - Intergenic
1185660809 X:1727559-1727581 GCTTCAGTAGGATGTTGTGTTGG + Intergenic
1191046421 X:56142817-56142839 TCCTCAGTATGCTGTTGGATAGG - Intergenic
1192195061 X:69022501-69022523 TCCTCAGTGGCCAGTAGGGTGGG + Intergenic
1194286692 X:92019947-92019969 GCCTCATGTGGCTCTTGGGTGGG - Intronic
1198021506 X:132663068-132663090 ACCTCATTGGGCTGTTGGTGAGG - Intronic
1200171038 X:154074983-154075005 TCCTCACTGGGCTCTTGGGTTGG - Intronic
1200604238 Y:5244507-5244529 GCCTCATGTGGCTCTTGGGTGGG - Intronic
1200746776 Y:6910509-6910531 CCCTCAGCTGGCTGTTGGGGAGG + Intergenic