ID: 1154326189

View in Genome Browser
Species Human (GRCh38)
Location 18:13392488-13392510
Sequence TCCTCTGAGCAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 8, 3: 36, 4: 357}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154326182_1154326189 -3 Left 1154326182 18:13392468-13392490 CCTAAAAACAAACCCCCAGTTCC 0: 1
1: 1
2: 2
3: 21
4: 256
Right 1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG 0: 1
1: 0
2: 8
3: 36
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154326189 Original CRISPR TCCTCTGAGCAGAGGGAAGC AGG Intronic
900347207 1:2215462-2215484 CCCTCTGAGTAGCGGGAAGGTGG + Intergenic
900611831 1:3547526-3547548 GCCTCAGAGCCAAGGGAAGCCGG - Intronic
900807570 1:4777513-4777535 TGCTCTGGGCAAAGTGAAGCTGG + Intronic
900827868 1:4941064-4941086 TCCACTCAGAAGAGGGCAGCAGG + Intergenic
901241301 1:7695297-7695319 AGCTCTGAGCAGAGAGAAGAGGG + Intronic
901843155 1:11966230-11966252 TCCTGTGGGAAGTGGGAAGCAGG - Exonic
902662486 1:17914787-17914809 TCATCTGAACTCAGGGAAGCAGG - Intergenic
902733765 1:18386660-18386682 TCCTTTGAAGAGTGGGAAGCAGG - Intergenic
903649555 1:24914485-24914507 CCCTGTGAGCAGATGAAAGCCGG + Intronic
904090476 1:27941596-27941618 TGCTCTGAGAAAAAGGAAGCTGG + Intronic
904377743 1:30092435-30092457 TCCTCAGAGCGCAGGGGAGCTGG + Intergenic
906128139 1:43440015-43440037 TCCTCTGTACATAGTGAAGCTGG - Exonic
906932601 1:50184196-50184218 TTCACTGAGCAGAGAGAAGAGGG - Intronic
907117044 1:51978100-51978122 TTCTGGGAGCACAGGGAAGCTGG - Intronic
909474851 1:76071478-76071500 GCCTCTGAGGAGAGGGAAGGTGG + Intergenic
910173531 1:84403515-84403537 TCAGCTGAGCAGAAGGAAGAAGG + Intronic
912691263 1:111806061-111806083 TCCTCAGAGCAGAGGGTGCCTGG - Intronic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
913500289 1:119466833-119466855 TCTTCTGAGAAAAGGGATGCCGG + Intergenic
913515362 1:119600956-119600978 TCTTCTGAGAAAAGGGATGCTGG + Intergenic
914336989 1:146724529-146724551 TTCTCTGAGCAGAGGAACCCAGG - Intergenic
914804839 1:150984245-150984267 TCCTCACAGCAGAGGGACGGGGG - Intronic
915020876 1:152777455-152777477 TCCTCTGAGCTCAGGGACCCCGG - Intronic
915983404 1:160438271-160438293 TCCTCTGGGCAGAAGGAGGGAGG - Intergenic
917923606 1:179771040-179771062 CCCTGTCAGCAGAGGGCAGCAGG - Intronic
918093002 1:181313696-181313718 TCCTGGGAGCAGACGGAGGCTGG - Intergenic
919464985 1:197915940-197915962 TCCCCCGGGCGGAGGGAAGCGGG + Intronic
920250065 1:204617557-204617579 GCCTCTGGGCAGAGAGAAGATGG + Exonic
921894926 1:220390069-220390091 TCCTATGAGCAAAGGGAAAGGGG + Intergenic
922813061 1:228428912-228428934 CCCGATGAGCAGAGGGCAGCAGG - Intergenic
922878532 1:228960825-228960847 GCCTCTGACCAGAGGGGAGAGGG + Intergenic
923207022 1:231768969-231768991 TCCTGTGTTCAGAGGGCAGCTGG + Intronic
923863605 1:237916735-237916757 TCCTCAGAGGAGAGGAAAGAGGG - Intergenic
1062823484 10:551593-551615 TTCTCTGAGCCCAGGGAAGATGG - Intronic
1063009038 10:2004439-2004461 TCCTCTGAGGAGAGGAGACCTGG + Intergenic
1064005840 10:11698303-11698325 CCAACTGAGCAGAGGGTAGCAGG - Intergenic
1064243578 10:13651971-13651993 TTCTCTGAACAAAGGAAAGCAGG + Exonic
1065479448 10:26177648-26177670 TCTTCTGGGCAGAGGTCAGCAGG - Intronic
1066596179 10:37052454-37052476 TCCTTTTAGCAAAGTGAAGCTGG + Intergenic
1067048128 10:42997357-42997379 ACATGTGATCAGAGGGAAGCTGG - Intergenic
1067655809 10:48190356-48190378 TCCTTTGACCAAAGGGAAGTAGG + Intronic
1067671382 10:48325268-48325290 TCTTCTTAACAGAGGAAAGCTGG - Intronic
1067842979 10:49696740-49696762 TCCTCTGAGCAGTGGGATTGGGG + Intronic
1068423081 10:56821654-56821676 TCCCCTGTGCAGAGGGAGGGGGG - Intergenic
1068630374 10:59291443-59291465 GCTCCTGAACAGAGGGAAGCTGG - Intronic
1069814980 10:71188114-71188136 TCCTCCCAGCAGAGGGGAGGAGG + Intergenic
1070310762 10:75272094-75272116 TCCTCAGGGCAGAGGGCTGCGGG + Intergenic
1070541583 10:77419079-77419101 TCCCCTGGACAGAGGGAAACTGG + Intronic
1070770047 10:79077028-79077050 TCCTCTGTGTATGGGGAAGCAGG + Intronic
1070776810 10:79114585-79114607 TGCTCTTAGCAGAGAGGAGCTGG - Intronic
1070953108 10:80446584-80446606 ACCTCTGAGCAGGGGCAAGCAGG - Intergenic
1073067772 10:100773922-100773944 TCCTGGGAGCTGGGGGAAGCAGG - Intronic
1074947625 10:118296565-118296587 TCCTCTGAGGAGAAGGAGGCAGG - Intergenic
1075077928 10:119363682-119363704 GCCTCTGGGAAGAGGGAAGCTGG + Intronic
1075660769 10:124194022-124194044 TCTTTTGAGCAGAAGGAAGAAGG + Intergenic
1075871020 10:125772967-125772989 GCCTGGGAGCAGAGGGGAGCGGG + Intronic
1076225091 10:128768185-128768207 TTCTTTGAGGGGAGGGAAGCTGG + Intergenic
1076299386 10:129413293-129413315 TCATCTCAGAAGAGGGAAGACGG + Intergenic
1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG + Intergenic
1077838258 11:5944355-5944377 GCCTATGAGCTGTGGGAAGCAGG + Intergenic
1078462191 11:11522395-11522417 TCCTCCCATCAGAGGGAAGGAGG + Intronic
1080730607 11:34948426-34948448 TGCTCAAAGCAGAGGTAAGCTGG - Intronic
1081660154 11:44883125-44883147 TCTTGGGAGCAGAGGGAAGGTGG - Intronic
1081765726 11:45608673-45608695 TCCTCTCAGCTGAGGGAATTGGG - Intergenic
1082767438 11:57180645-57180667 TCGCCTGTGCAGAAGGAAGCTGG + Intergenic
1082782774 11:57300268-57300290 GTCCCTGAGCACAGGGAAGCAGG + Intronic
1083047922 11:59753539-59753561 CCCTCTGAGCAGAGGCAGACAGG + Intronic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083438915 11:62663156-62663178 TCCACTGAGTAAAGGGAAGAAGG + Exonic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084502209 11:69541423-69541445 GCCTCAGAGCAGAGGACAGCTGG + Intergenic
1084566954 11:69935267-69935289 TCCCCTGTGGAGAGGGAACCAGG - Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084914686 11:72419751-72419773 TCCTCTGACCAGGGGAAATCTGG + Intronic
1086662829 11:89442930-89442952 TGATTTGAGCAGAGGGCAGCAGG + Intronic
1087897308 11:103601092-103601114 TCCTCTGTTCAAAGGGAAACAGG - Intergenic
1088853914 11:113729096-113729118 TCCTGGGAGCAGAGGCAAGCGGG + Intergenic
1088988678 11:114931328-114931350 ACCTCTGAGCAGAGAGAAGTAGG + Intergenic
1089466156 11:118687908-118687930 TCCTCTGATCAGAGTGAGGTGGG - Intergenic
1089581678 11:119485297-119485319 TCCTGGGAGCAGAGGCAAGACGG - Intergenic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1090185154 11:124734042-124734064 ACCTCTGGGCAGAAGGAAGGGGG - Intergenic
1090960968 11:131556275-131556297 TCCCCCAAACAGAGGGAAGCAGG + Intronic
1091730761 12:2878335-2878357 TCCTCTAAGCAGAGGGAATCAGG + Intronic
1092986192 12:13848409-13848431 TGCCAGGAGCAGAGGGAAGCAGG + Intronic
1093659889 12:21744079-21744101 TTCTCTGAGCAGATGCCAGCAGG - Intronic
1095295111 12:40518670-40518692 TTCTCTGAGCACAGGGAAGGTGG - Intronic
1096111362 12:49031147-49031169 TACTCTGAGTAGAGTGGAGCAGG - Intronic
1097090415 12:56500232-56500254 TCCTCAGAGGAGAGGAAAGAGGG + Intergenic
1100898575 12:99213226-99213248 TGCTCTGGGTAGAGAGAAGCAGG - Intronic
1102556822 12:113732155-113732177 TCCCCAGAGCGGAGGGAAGGGGG + Intergenic
1102986520 12:117282943-117282965 TACACTGTGCTGAGGGAAGCAGG - Intronic
1103047788 12:117752214-117752236 GCCTGTGAGCAGAGAGAACCAGG - Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1104631634 12:130407819-130407841 TGATCTGAACAGAGAGAAGCAGG - Exonic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105603801 13:21910240-21910262 TTCTCTGAGGACAGGGAAGATGG - Intergenic
1106226520 13:27790668-27790690 TCCGCTGGGCAGAGGCAGGCTGG - Intergenic
1106234497 13:27850738-27850760 ACCACTGTGCTGAGGGAAGCAGG + Intergenic
1108457446 13:50630472-50630494 TTCTCTGAGCATATGCAAGCTGG + Intronic
1110733842 13:78911714-78911736 TCCACTGAGATGGGGGAAGCAGG - Intergenic
1111825466 13:93262264-93262286 TCCCCTCAGCAGAGGAAAGAAGG + Intronic
1112165450 13:96914222-96914244 TGCTCTGAGCAGAGGACATCTGG + Intergenic
1112702186 13:102022493-102022515 TCCTCTGAGCAGATGGAGTGAGG - Intronic
1113296153 13:108960889-108960911 ATCTTTGAGCAGAGGGTAGCAGG - Intronic
1113354502 13:109565712-109565734 ACCCCTGAGGAGAGGGCAGCAGG - Intergenic
1113595817 13:111531003-111531025 GTCCCTGGGCAGAGGGAAGCAGG - Intergenic
1113790131 13:113023868-113023890 TCCTCAGAGCAGGTGGATGCAGG + Intronic
1116569667 14:46499547-46499569 TCCACAGAGGAGAGGCAAGCTGG - Intergenic
1117049632 14:51847241-51847263 TCCTCTGTGCTGAGGGGAGAAGG - Intronic
1117119311 14:52551945-52551967 ATCTGTGAGCAGGGGGAAGCTGG - Intronic
1119024193 14:71139660-71139682 CCCTCTGTGCGGATGGAAGCAGG - Intergenic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1119639368 14:76303178-76303200 GCCTTTGAGCAGAAGGAAGCAGG + Intergenic
1119653615 14:76400859-76400881 TGCTCTGTGCAGAGGGCAGCTGG + Intronic
1120928176 14:89819333-89819355 TTATCTGAGAAGAGGGAAGGGGG + Intronic
1121016333 14:90551576-90551598 GCCATTGATCAGAGGGAAGCAGG + Intronic
1121448339 14:93992539-93992561 TGCTCTGACCAGAGGGAACCAGG - Intergenic
1122621554 14:103060396-103060418 TCCTATGATCAGAGTGGAGCTGG - Intergenic
1122838893 14:104444975-104444997 TTCCCTGTGCAGAGGAAAGCCGG + Intergenic
1122981620 14:105194732-105194754 TCCTCTGAGAAGAGGACACCAGG - Intergenic
1124355882 15:28994499-28994521 TCCCCTGAGCAGAGGCAAGCAGG + Intronic
1124626882 15:31312736-31312758 GCCTCTGAGCAGAGATAAGGGGG - Intergenic
1125523375 15:40360312-40360334 TCCTGAGATCAGAGGGCAGCAGG + Intronic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1128090908 15:64918335-64918357 GCCTGGGAGCAGAGAGAAGCCGG - Intronic
1128558785 15:68650911-68650933 TCATCTGACCAGAGGGCAGCAGG - Intronic
1128874139 15:71188367-71188389 TCCTCTGGGAAGAGGAGAGCAGG + Intronic
1129232365 15:74203874-74203896 TCCGCTGAGCAGAGGGTGGCAGG + Intronic
1130871865 15:87978176-87978198 TCCACTGAGGAGAGGGAAGGGGG - Intronic
1132314619 15:100880507-100880529 TCCTCCGAGCAAAGCGCAGCGGG + Intronic
1132678521 16:1130493-1130515 GCCTCAGAGGAGAGGGATGCAGG - Intergenic
1133778247 16:8915024-8915046 TCCTGTGAGGAGAGGGGAGGTGG + Intronic
1135382223 16:22004698-22004720 TCCTATGGGGAAAGGGAAGCAGG - Intergenic
1135472691 16:22745660-22745682 TTCTTTAAGCAGAAGGAAGCAGG - Intergenic
1135503878 16:23019874-23019896 TTCTCTGAGCTGAGGAGAGCAGG - Intergenic
1135922998 16:26667950-26667972 GCCTCTGAGCAGTGAGCAGCTGG - Intergenic
1138133108 16:54499105-54499127 GCCTTTGCCCAGAGGGAAGCTGG - Intergenic
1139418246 16:66831558-66831580 TCCTCTAGATAGAGGGAAGCAGG + Intronic
1139997280 16:70992790-70992812 TTCTCTGAGCAGAGGAACCCAGG + Intronic
1140277836 16:73526685-73526707 TTATCTGAGCCAAGGGAAGCAGG + Intergenic
1141723170 16:85768113-85768135 ACACCTGGGCAGAGGGAAGCAGG - Intergenic
1141738129 16:85869072-85869094 TTCACTGTGGAGAGGGAAGCAGG + Intergenic
1141884424 16:86881995-86882017 TCTGCTGTGCAGAGAGAAGCTGG - Intergenic
1142207467 16:88790985-88791007 TCCTCTGAGCAGCAGCAGGCAGG - Intergenic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142482054 17:225163-225185 GCCTCTGAGCAGATGGAGGAAGG - Intronic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143351466 17:6291207-6291229 TCCTCCCAGCAGAGGGAAGAAGG - Intergenic
1143639329 17:8186666-8186688 ACCTCTCAGCAGAGGGACGAGGG + Intergenic
1143965137 17:10751601-10751623 TCCTCTCAGCAGCAGGGAGCAGG + Intergenic
1143992854 17:10981349-10981371 TCATATGAGCAAAGGGAAGGAGG + Intergenic
1144442166 17:15293279-15293301 ACCTCTGAGAAGATGGAAGAAGG - Intergenic
1145240473 17:21238098-21238120 TTCTCTGATCACAGAGAAGCTGG + Intergenic
1145823524 17:27858916-27858938 TCATCTGGGTAGAGGGTAGCTGG + Intronic
1145908111 17:28527382-28527404 TCCTCAGACCTGGGGGAAGCAGG - Intronic
1146549581 17:33768913-33768935 CTCTCAGAGGAGAGGGAAGCTGG - Intronic
1146676520 17:34777097-34777119 TACACTGAGCAGAGAGAGGCAGG - Intergenic
1146793355 17:35765217-35765239 TCCTCTGCGCAGTGGGCAGAAGG - Intronic
1146929334 17:36766695-36766717 TTCTCTATGCAAAGGGAAGCTGG + Intergenic
1148454968 17:47806281-47806303 TCCTCTAGGCACTGGGAAGCAGG + Intergenic
1148462556 17:47846937-47846959 TCCCCGGAGCAGAGAGAAGTGGG - Exonic
1148824056 17:50379116-50379138 TCCTCCAAGAAGAGGGAAACAGG + Exonic
1148858599 17:50592452-50592474 CCCTCTGAGCCGAGGGGTGCAGG + Intronic
1149029209 17:52064914-52064936 TCCTCTGAGATCTGGGAAGCAGG - Intronic
1149659874 17:58328704-58328726 TCCCCAGAGCAGAGGCCAGCAGG - Intronic
1149682678 17:58517137-58517159 ACCTGTGATCAGAGGGCAGCAGG + Intronic
1150060025 17:62059607-62059629 TCCCCTGAGAAGAGAGCAGCTGG - Intronic
1150212179 17:63447240-63447262 TCCTCCCCGCAGAGGGAAACCGG + Intergenic
1150584898 17:66508589-66508611 TCCTGTGTGCAGAGGACAGCTGG - Intronic
1152040021 17:77897130-77897152 TCCTGGGAGCAGGGGGGAGCTGG - Intergenic
1152460660 17:80440549-80440571 GCCTCTGAGAAGGGGGAATCAGG - Intergenic
1152484159 17:80578844-80578866 GCCTGGGAGCAGAAGGAAGCAGG + Intronic
1152896168 17:82912655-82912677 TGGTCTGAGCAGAGGAGAGCAGG + Intronic
1153729822 18:7999510-7999532 TTCTCTGAGCAGAGGCAAGTGGG + Intronic
1153799379 18:8656053-8656075 TCCTCTGGGCTGGGGGAACCAGG + Intergenic
1154046960 18:10915241-10915263 TCACGTGTGCAGAGGGAAGCAGG + Intronic
1154174702 18:12077787-12077809 TCACGTGTGCAGAGGGAAGCAGG - Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1155101519 18:22615023-22615045 GCCTATGAGCAGAAGGCAGCGGG + Intergenic
1155911908 18:31513690-31513712 TCCTCAGGGCAGAGGGAAGCGGG - Intronic
1155934962 18:31744317-31744339 TCCCCTGTACAGAGGGAAGGGGG + Intergenic
1156892873 18:42209861-42209883 TCAACTGAGCAGAGGGAATCAGG - Intergenic
1157911367 18:51620169-51620191 TGGTCAGAGCACAGGGAAGCTGG + Intergenic
1157984502 18:52421610-52421632 TCCACGGAGCATAGGGAATCAGG + Intronic
1158187147 18:54783730-54783752 GCCTATGCCCAGAGGGAAGCAGG - Intronic
1158971610 18:62673368-62673390 TCTTCGGAGAAGAGAGAAGCTGG - Intergenic
1159917133 18:74197945-74197967 TCCCCTGGGCTCAGGGAAGCTGG - Intergenic
1160442580 18:78903672-78903694 TCTTCTGAGCAGTTGGAGGCAGG + Intergenic
1160855138 19:1213860-1213882 TGCTCTGAGCCGTGGGAGGCCGG + Intronic
1161286737 19:3472223-3472245 TCCTCTCTGCAGCGGGAAACGGG + Intergenic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1162412887 19:10517242-10517264 GCCTCTGGGGAGGGGGAAGCTGG - Intronic
1163369324 19:16893296-16893318 TCCTGTGAGCAGCGGGAACCTGG - Exonic
1163826891 19:19528993-19529015 TCAGCTGGGGAGAGGGAAGCTGG + Intronic
1164084512 19:21889047-21889069 TCCTCAGAGGAGAGGAAAGAGGG + Intergenic
1164814136 19:31181408-31181430 CCATCTGAGCAGAGAGAAGAAGG + Intergenic
1167115972 19:47489269-47489291 TCCACCAGGCAGAGGGAAGCTGG + Intronic
1167378641 19:49125831-49125853 TCCTGTGACCTGAGGGAGGCGGG + Intronic
1168189235 19:54725982-54726004 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168199515 19:54804722-54804744 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168203949 19:54835771-54835793 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168206130 19:54851927-54851949 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168335855 19:55597479-55597501 TACTCTGGGCAAAAGGAAGCTGG - Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
927374754 2:22400927-22400949 TGCTCAGAGCAGAGAGAAGTAGG + Intergenic
927745338 2:25614740-25614762 TCCTCTAAGGAGATGGAGGCGGG + Intronic
927956593 2:27211730-27211752 TCCGCCGCGTAGAGGGAAGCGGG - Intronic
928374170 2:30761545-30761567 TCCTCTGAACACAGGGGAGAAGG - Intronic
929891701 2:45923793-45923815 TTCTAGGAGCAGAGGGAAGGAGG + Intronic
930698433 2:54434573-54434595 TCTTCTGAGCAGAGGAGACCTGG - Intergenic
931692701 2:64848714-64848736 GCCTCTGAGCATGGGCAAGCTGG + Intergenic
932125741 2:69144236-69144258 GCCACTGGGCAGAGGGAGGCTGG - Intronic
932551961 2:72780330-72780352 TCCTCTCAGCAGAGCAAAACAGG + Intronic
932595243 2:73089314-73089336 ACCTGTGAGAAGAGGGGAGCAGG + Exonic
934562989 2:95322870-95322892 TGCTCTGAGCAGAGGGGCACAGG - Intronic
935640603 2:105286409-105286431 TCATCTGAGCAGAGGGCAGGAGG - Intronic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
937631425 2:124106412-124106434 ACCTCTGGGCAGAGGAAAGAGGG + Intronic
938977944 2:136496983-136497005 ACATCTGAGAAGAGGAAAGCTGG + Intergenic
939631416 2:144530254-144530276 TTCTCTGTGTTGAGGGAAGCTGG + Intergenic
939848283 2:147274110-147274132 TCTTCTGCTCTGAGGGAAGCTGG - Intergenic
939906755 2:147925747-147925769 TCCTCTGTGCAGATGGAAATAGG + Intronic
939911782 2:147992143-147992165 TTCTCTGAGCACATGGAAGTAGG + Intronic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
942510038 2:176688310-176688332 TCATCTGAGCAGAGGGAGATGGG + Intergenic
943345754 2:186735003-186735025 CCCTGAGAGCAGAGGGATGCTGG + Intronic
944013689 2:195005984-195006006 TCCTCTTAACAGATGGAAGTTGG - Intergenic
945874942 2:215268127-215268149 CCCTCAGGTCAGAGGGAAGCTGG - Intergenic
946156862 2:217812723-217812745 TCCTCTGAGAACAGGGCAGAAGG + Intronic
948118660 2:235512743-235512765 GCCACTGAGCAGAGGCAGGCAGG - Intronic
948185583 2:236019038-236019060 TCCTCTGAGCAGATGTGAGCAGG + Intronic
1168961578 20:1873676-1873698 TCCTCTGAGCTAAGAGAAGGAGG - Intergenic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1170134300 20:13055925-13055947 TCATCTGAGCTGAGGGAAGGGGG + Intronic
1171097932 20:22350130-22350152 TCCTCTGCAGAGAAGGAAGCTGG + Intergenic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1173169771 20:40714588-40714610 GCCTCTGAGGACAAGGAAGCTGG + Intergenic
1174400251 20:50272157-50272179 TTCTCTGAGCAGAAGGAAGTGGG - Intergenic
1174614240 20:51823705-51823727 TCCTCTGAGAAGAGTTAATCAGG + Intergenic
1175225107 20:57440039-57440061 TATTCTGAGCAGCGGGAAGCTGG - Intergenic
1176119904 20:63449719-63449741 TCCTGGGAGAAGAGGGAAGAGGG + Intronic
1176120472 20:63452309-63452331 GCCTCTGAGCTGAGGGCAGCAGG + Intronic
1176260723 20:64178090-64178112 GCCTCTGTGAAGAGAGAAGCTGG - Intronic
1176517570 21:7797500-7797522 TCCACACAGCATAGGGAAGCAGG - Intergenic
1176717861 21:10368512-10368534 ATTTCTGAGAAGAGGGAAGCAGG + Intergenic
1177862702 21:26473567-26473589 TCCACTGAGCACAGTGAAGGGGG - Intronic
1178431197 21:32520202-32520224 TCCTCTCAGCAGCTGGAGGCTGG - Intergenic
1178651598 21:34427512-34427534 TCCACACAGCATAGGGAAGCAGG - Intergenic
1178719047 21:34992134-34992156 CCCTCTCAGGAGAGTGAAGCGGG + Intronic
1180012063 21:45058070-45058092 TCCGCTGGGCTGTGGGAAGCAGG + Intergenic
1180299087 22:11021418-11021440 ATTTCTGAGAAGAGGGAAGCAGG + Intergenic
1180824495 22:18853307-18853329 GCAGCTGCGCAGAGGGAAGCAGG - Intronic
1180945258 22:19689024-19689046 GCCTGTGAGCAGAGGGTGGCAGG - Intergenic
1181124918 22:20696462-20696484 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181188239 22:21121241-21121263 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1181210957 22:21289252-21289274 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181235548 22:21445940-21445962 CCCTTTGAGCGGAGAGAAGCAGG + Exonic
1181923073 22:26335753-26335775 TGCTCTGACCAGAGGCAGGCAGG + Intronic
1182274517 22:29177924-29177946 TTCTCTGGGCAGAGGGTAGGTGG + Intergenic
1182586204 22:31345656-31345678 TCCCCTCAGCAGCGAGAAGCGGG + Exonic
1183177286 22:36233283-36233305 TCCTGTGTACAGAGGGAGGCTGG + Intronic
1183319430 22:37156059-37156081 TCCAGTGAGCAGAGGGAGGACGG - Intronic
1185161664 22:49233666-49233688 TCCTCTGAGCAGAGGGAGGTGGG + Intergenic
1185392731 22:50571344-50571366 CCCTCTCAGCAGCGGGAGGCGGG + Intronic
1203215988 22_KI270731v1_random:6178-6200 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
950398674 3:12753651-12753673 TCCTCTAACCAGGGGGCAGCTGG - Intronic
950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG + Intergenic
950863208 3:16168824-16168846 TCCCCTGAGAAGAGGGATGTGGG + Intergenic
952385399 3:32837943-32837965 TCCTCTGAGCAGATGCCTGCTGG + Intronic
952387417 3:32852277-32852299 TTCTCTGACCAGAGGGAGGGTGG + Intronic
952648279 3:35689209-35689231 TTATCTGAGCAGGGGGAAACAGG + Intronic
954330573 3:49887863-49887885 TCCTCTGATCACAGAGAAGTAGG + Intronic
954407803 3:50355242-50355264 TGCTCTGAGGAGAGGGAAGAAGG - Exonic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
955750361 3:62180346-62180368 TTGTCTCAGCAGTGGGAAGCAGG + Intronic
955916379 3:63912290-63912312 TCCTCTGAGCAGAAGCAGGCAGG + Intronic
960739211 3:120814542-120814564 TCTTAAGAGCAAAGGGAAGCTGG - Intergenic
960989181 3:123299820-123299842 TCCTCTGAGCCTGGGGCAGCTGG + Intronic
961059037 3:123812895-123812917 TCCTGTGGGCACAGGGAAGGGGG + Intronic
961085145 3:124060834-124060856 TCCACCTAGCAGAGGGAAGGTGG - Intergenic
961551009 3:127670743-127670765 GCATCTTAGCAGAGAGAAGCAGG - Intronic
961643676 3:128381055-128381077 TCCCCTAAGCAGAGTGGAGCTGG + Intronic
961832887 3:129633282-129633304 TCCACTGAGCAAAGGGCAGAGGG + Intergenic
962873089 3:139515237-139515259 TCCTCTGAGCAGAATTAATCAGG - Intergenic
963142704 3:141960943-141960965 TCCTTTGAGTGGAGGGAAGGAGG - Intronic
963923782 3:150930226-150930248 TTAGCTGAGCAGAGGGAGGCTGG + Intronic
966744014 3:183258534-183258556 TCCTCTGAGATGAGGGAAGCAGG - Intronic
966916477 3:184587032-184587054 TCCTCTGATCTGTGAGAAGCAGG - Intronic
968882565 4:3309040-3309062 TCCTCTGAGGAGAGCTGAGCAGG + Intronic
968882687 4:3309518-3309540 TCCTCTGAGGAGAGCTGAGCAGG + Intronic
968882744 4:3309730-3309752 TCCTCTGAGGAGAGCTGAGCAGG + Intronic
968882847 4:3310100-3310122 TCCTCTGAGGAGAGCTGAGCAGG + Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
969367244 4:6703666-6703688 TCCTCTGAGCAGGGTGAAGAGGG - Intergenic
969702046 4:8773161-8773183 TCCTGAGAGCAGAGAGAGGCGGG + Intergenic
969999035 4:11345297-11345319 TCCTCTAAGCAGAGTGAGGCAGG - Intergenic
970050105 4:11904850-11904872 GCACCTGAGAAGAGGGAAGCAGG + Intergenic
972737461 4:41857508-41857530 TCCTCTGAGACGAGGCAGGCCGG + Intergenic
976524230 4:86067796-86067818 TCCGCTGGGAAGAGGGAATCTGG + Exonic
977486046 4:97647789-97647811 TGTTCTGGGCAGAGGGAAACAGG + Intronic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
981315530 4:143336663-143336685 TCCCCCGAGGAGAGGGAAGGAGG + Intergenic
981548593 4:145919430-145919452 TGCTCTAAGCAGAGTGATGCAGG - Intronic
981782103 4:148442343-148442365 TCCTCTGAGCAGCCTGAAGTTGG + Exonic
983996956 4:174193712-174193734 AGCTCTGAGCTGAGGGAAACAGG + Intergenic
985525644 5:400125-400147 TCCTCGGAGTAAAGGGAAGTTGG - Intronic
987009058 5:13741289-13741311 TGCTCTGAGCACAGTGAATCAGG + Intronic
988507926 5:31840141-31840163 TCACCTGAGCCCAGGGAAGCAGG + Intronic
989204322 5:38796553-38796575 TCCTCTGAGCTGAGGGTGGGTGG + Intergenic
989499077 5:42144797-42144819 ACCTCTGAACACAGTGAAGCTGG + Intergenic
989565938 5:42901083-42901105 TCAGCAGAGCAGGGGGAAGCAGG + Intergenic
989573665 5:42969376-42969398 TCAGCAGAGCAGGGGGAAGCAGG - Intergenic
992409944 5:76495521-76495543 TCCTGTGAGGAGAGGGATGATGG - Intronic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
996575939 5:124976490-124976512 TCCTGCAAGCAGAGGGAGGCTGG + Intergenic
997579481 5:135008254-135008276 TCATCTGGGCCTAGGGAAGCTGG + Intronic
997585397 5:135040351-135040373 GCCCCTGAGGAGAGGGAAGAAGG - Intronic
998761143 5:145433616-145433638 ACCTCTGAGGAGAGGGTACCTGG - Intergenic
1000857153 5:166412788-166412810 TTTTCTGAGAAGAGGGAAGGTGG + Intergenic
1001241604 5:170075713-170075735 TCCTATGAGGCAAGGGAAGCTGG + Intronic
1001546999 5:172576450-172576472 TCCAAAGGGCAGAGGGAAGCAGG + Intergenic
1002014420 5:176308137-176308159 TGCTCTGAGCACAGAGAAGGAGG + Intronic
1002078933 5:176726473-176726495 TCCTCTGAGCAGGGTGAAGGAGG - Intergenic
1002211461 5:177601923-177601945 TCCTCATAGGAGAGGGGAGCAGG + Intronic
1002602772 5:180363428-180363450 TCCCCAGTGGAGAGGGAAGCAGG - Intergenic
1002988878 6:2219134-2219156 TCCTCTGAGAAGAGGAAATGGGG + Intronic
1003635793 6:7830408-7830430 ACCTCTGAGCAGAAAGAGGCTGG - Intronic
1005967170 6:30734943-30734965 TCATCTGCTCAGAGGGAAGAAGG + Intronic
1006266649 6:32931345-32931367 GCCTAAGAGCAGAGGGAAGAGGG + Intergenic
1006358980 6:33577091-33577113 TCCCCTGGGAAGAGGGAAGGAGG + Intronic
1007453835 6:41960978-41961000 TCCCCTCAGCAGAGGGAAGCTGG + Intronic
1012858378 6:104529175-104529197 TCCTCTGAGCAGAGAGGATGGGG - Intergenic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1015868086 6:137747970-137747992 TTTTCTTAGAAGAGGGAAGCAGG + Intergenic
1016516100 6:144894548-144894570 TCCTCCCAGCAGAGGGAAGGGGG + Intergenic
1017261175 6:152389565-152389587 TACTCTGAGAAGAGGGAGGTAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1019291158 7:251044-251066 TGCTCTGAGCAGAGCCAGGCAGG - Intronic
1019699249 7:2465698-2465720 TCCACTGACCAGAGGGTAGATGG - Intergenic
1023277481 7:38535491-38535513 TCCACTGACCAGAGGGTGGCGGG + Intronic
1024250343 7:47501487-47501509 TGCCCTGAGCAGAGCGGAGCTGG + Intronic
1024256560 7:47544168-47544190 TCCTCTGAAGGGAGGGAAGGGGG - Intronic
1026462862 7:70630212-70630234 TCCTCAGAGGAGCGGAAAGCTGG + Intronic
1026804014 7:73418332-73418354 ACCTCTGTGCAGAGGGAATGAGG + Intergenic
1026982797 7:74536424-74536446 TTCTCTAGGCAGAGGGAAGTAGG - Intronic
1030689737 7:112520067-112520089 TCCTATGAGGAGAGGGTAGATGG - Intergenic
1032380961 7:131480179-131480201 TTCACTGACCAGAGGAAAGCTGG - Intronic
1034093112 7:148382168-148382190 TCCACTGAGCAGCCAGAAGCTGG - Intronic
1034452443 7:151144193-151144215 GCCTGTGAGGAGAGGGGAGCAGG + Exonic
1035232074 7:157471279-157471301 ACCTCAGACCAGAGGGAAGCCGG + Intergenic
1035395432 7:158531774-158531796 TTCTATGAGCAGAGGGCAGGTGG - Intronic
1035629589 8:1097529-1097551 TCTACTGAGCAGAGGGAGGTGGG - Intergenic
1035629656 8:1097799-1097821 TCTCCTGAGCAGAGGGAGGTGGG - Intergenic
1036261253 8:7242025-7242047 TCCTCTAATCAGAAGAAAGCTGG + Intergenic
1036305349 8:7597525-7597547 TCCTCTAATCAGAAGAAAGCTGG - Intergenic
1036313292 8:7700569-7700591 TCCTCTAATCAGAAGAAAGCTGG + Intergenic
1036356200 8:8045522-8045544 TCCTCTAATCAGAAGAAAGCTGG - Intergenic
1037386263 8:18345534-18345556 TCCTATGGGCAGGGGGAAGGAGG + Intergenic
1039555972 8:38475233-38475255 TCCTCTGGGCAGAGGCAGCCGGG - Intergenic
1040718027 8:50282148-50282170 TTCTCTGGCCAGAGGGGAGCTGG - Intronic
1040856529 8:51954155-51954177 TTCTGTGAGCAGGGAGAAGCCGG - Intergenic
1042865020 8:73349407-73349429 TGCCCTGAGAAGAGGGATGCAGG - Intergenic
1044703691 8:94987695-94987717 TCCTATGAAGAGAGGAAAGCTGG + Intronic
1044813692 8:96089394-96089416 TCCTATGGGCAGAGGGAAGTGGG - Intergenic
1045296276 8:100874131-100874153 TCCTGTCTGCAGAGAGAAGCAGG - Intergenic
1046287720 8:112116507-112116529 GACTCTGAAAAGAGGGAAGCAGG + Intergenic
1048259487 8:132933731-132933753 TGCTCTGAGGAGCGGGCAGCAGG + Intronic
1048771530 8:137900741-137900763 TCCTCTGAAGAGCGGGAAGAGGG + Intergenic
1049575845 8:143389241-143389263 CCCTGTGAGGAGGGGGAAGCCGG - Intergenic
1049938994 9:526688-526710 TCCTCTGAGGAGAGGGAATCAGG - Intronic
1050297725 9:4222889-4222911 TGCACTGAGCAGAGGGAACGGGG + Intronic
1050775684 9:9257224-9257246 AACTCTGAGCAGAAGGAAGGAGG + Intronic
1051544375 9:18257944-18257966 TCTTCAGAGCAGAAGGAAGGAGG + Intergenic
1052575179 9:30282183-30282205 TCCTCTGGGAGGAAGGAAGCTGG + Intergenic
1053429646 9:38033642-38033664 TCCTCTGATCAGTGGGCAACAGG + Intronic
1055489217 9:76787795-76787817 TCCTGTGGGCAGTGGGAGGCGGG - Intronic
1057197049 9:93121068-93121090 TTCTCTGGGCACAGGGGAGCTGG - Intergenic
1059404964 9:114093835-114093857 GCCTCTGGACAGAGGGCAGCTGG - Intronic
1060176347 9:121499821-121499843 TGCTCTGGGCAGAGCGCAGCGGG + Intergenic
1060199716 9:121645404-121645426 TCCTGTGGGCAGAAGGCAGCAGG + Intronic
1060979150 9:127782843-127782865 TCCTCTGAGCAGAGACAGACGGG - Intergenic
1061055448 9:128220073-128220095 CCCCCTGCGCAGAGGTAAGCAGG + Exonic
1061226860 9:129285405-129285427 ACCTGTGAGCAGAGGGTACCTGG - Intergenic
1062121048 9:134834185-134834207 TCCCCTGAGTAGAGGGGTGCAGG - Intronic
1062252573 9:135605677-135605699 GGCTCTGAGCAGAGGGAGCCAGG - Intergenic
1062468721 9:136692748-136692770 TCCTGTGGGCAGAGGCAGGCGGG + Intergenic
1062567060 9:137168101-137168123 GTCTCTGAGCAGTGGGGAGCGGG + Exonic
1185542643 X:915804-915826 GTTTCTGAGAAGAGGGAAGCAGG - Intergenic
1186119165 X:6340071-6340093 TTCTCTGGGCAGAGGAATGCAGG + Intergenic
1188941983 X:36250832-36250854 TTCCCTGAGCAGTGGGAAGTAGG + Intronic
1189353512 X:40294808-40294830 TCCTCATAGCATCGGGAAGCAGG - Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190462085 X:50686893-50686915 TCTTGTGAACAGAAGGAAGCAGG + Intronic
1191762765 X:64662935-64662957 TGCTCTGAGCTGAGACAAGCTGG - Intergenic
1192227818 X:69241441-69241463 TCCTCTGAAGAAAGGCAAGCAGG + Intergenic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1200079929 X:153571284-153571306 TCCTGGGAGCTGAGGGCAGCAGG + Intronic