ID: 1154328481

View in Genome Browser
Species Human (GRCh38)
Location 18:13409678-13409700
Sequence CTTCTCCTCCAGCTTGCGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154328481_1154328483 20 Left 1154328481 18:13409678-13409700 CCATTCGCAAGCTGGAGGAGAAG 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1154328483 18:13409721-13409743 TAGTACATGTAGAAGAATTGAGG 0: 1
1: 0
2: 1
3: 18
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154328481 Original CRISPR CTTCTCCTCCAGCTTGCGAA TGG (reversed) Intronic
902824828 1:18965750-18965772 CTTCTCCACCAGCTTGCTGAAGG + Intergenic
903414689 1:23174122-23174144 CTGGTTCTCCAGCTTGCAAAAGG - Intronic
904273089 1:29363156-29363178 CTCCTTCTCCACCTTGGGAAGGG - Intergenic
905441863 1:38000955-38000977 CTTCTCCTTCAGCTTGAGCCAGG - Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
908245737 1:62226498-62226520 CTTCTCCTCCAGGTTACCTAAGG + Intergenic
909981391 1:82105709-82105731 CTGGTCCTCCAGCTTGTGGATGG - Intergenic
911380392 1:97106735-97106757 CTTGTTCTCCAGCTTGCAGATGG + Intronic
912332295 1:108830780-108830802 CCTCTCCTCCAGTTGGGGAAAGG + Intronic
915471103 1:156126345-156126367 CTTCTCCCCCAGATTGGGAGAGG + Intronic
916220932 1:162444670-162444692 TTTCTCCTCCAGTTTCAGAAAGG + Intergenic
919835135 1:201568183-201568205 CTGCTCCTCCAGCTTGGTGATGG + Intergenic
920030492 1:203034706-203034728 CTCCTCCTCCAGCCTGGGGAAGG - Intronic
922861641 1:228822997-228823019 CTACTCCTCCAGCTTGAAGATGG - Intergenic
1063337717 10:5232547-5232569 CTGCTTCTCCAGCTTGTAAATGG + Intergenic
1065163939 10:22954898-22954920 CTTATTCTCCAGCTTGCACATGG - Intronic
1065873151 10:29973365-29973387 GTTCACCCCCAGCTTGAGAAAGG + Intergenic
1066430876 10:35350044-35350066 CTCCTCCTCCAGCTTTGCAAAGG + Intronic
1067459558 10:46447652-46447674 CTTTTGCTTCAGCTTGCTAAAGG - Intergenic
1067627630 10:47936961-47936983 CTTTTGCTTCAGCTTGCTAAAGG + Intergenic
1069372026 10:67758189-67758211 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1072225111 10:93361501-93361523 CTTGTCCTCCAGGTTGGGAATGG - Exonic
1075158720 10:120003921-120003943 CTGCTTCTCCAGCTTGCAAACGG - Intergenic
1077319277 11:1933914-1933936 CTTCTCCTGCAGCCAGAGAAGGG - Exonic
1080186193 11:29489923-29489945 CTTCTACTCTAGCTTGTGACTGG + Intergenic
1080876848 11:36282811-36282833 CTGATCCTCCAGCTTGCAGACGG - Intronic
1081779244 11:45698664-45698686 CTTCTGCTCCAGCCTTTGAATGG - Intergenic
1083136975 11:60688308-60688330 CTTCTCCTCCAGGTTTCTGAGGG + Intergenic
1083653814 11:64219606-64219628 CTTCACCTCCAGGTTGCTCAGGG - Exonic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084544354 11:69807054-69807076 TTTCTCCTCAAGCTTGCAGACGG + Intergenic
1085692541 11:78675469-78675491 TTTTTCCTCCACCTTGAGAAAGG - Intronic
1087408137 11:97754870-97754892 CTTCTTTCCCAGCTTGCCAATGG - Intergenic
1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG + Exonic
1089794199 11:120967225-120967247 GTTCTCCTGCAGCTGGAGAATGG - Exonic
1090602395 11:128386640-128386662 CTTCTCCTCCAGGTGGTGTATGG - Intergenic
1090643999 11:128752862-128752884 TTTCTCCTCCAGTTTGGGCAAGG - Intronic
1091134727 11:133178558-133178580 CTTCTCATCCAGCTAGAGAAAGG + Intronic
1093415695 12:18917982-18918004 CTGAGCCTCCAGCTTGCAAAAGG + Intergenic
1094118648 12:26945268-26945290 CTTCTTCTCCAGGTTCCTAAAGG + Intronic
1094158178 12:27359852-27359874 CTGCTCCTCCAGATTCCAAATGG - Intronic
1094399631 12:30047992-30048014 CTGGTTCTCCAGCTTGCAAATGG + Intergenic
1099949782 12:89288891-89288913 CTGATTCTCCAGCTTGCAAATGG - Intergenic
1100464642 12:94834334-94834356 CTTCACCTCCAGCTTGCTGTTGG - Intergenic
1102535068 12:113575335-113575357 GTTCCCTTCCAGCTTCCGAAAGG + Intergenic
1103838977 12:123847427-123847449 CTGGTCCTCCAGCTTGCAGATGG - Intronic
1105217126 13:18294490-18294512 CTTCTCCTGCAGCGTCCGCATGG - Intergenic
1105752749 13:23436537-23436559 CTTGTTCTCCAGCTTGCAGATGG + Intergenic
1107420233 13:40239431-40239453 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
1113179377 13:107608379-107608401 TTTCTCCTCCAACTTGCAATAGG - Intronic
1115526375 14:34284475-34284497 CTGATCCTCCAGCTTGTAAATGG + Intronic
1116304156 14:43229192-43229214 CTACTTCTCCAGCTTGCAGATGG - Intergenic
1119096871 14:71840818-71840840 CTTCTCCTCAAGCATGAGGAAGG + Intergenic
1120250429 14:82056847-82056869 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
1120488667 14:85148345-85148367 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1122009450 14:98733768-98733790 ACTCTCCTCCAGCTTCCGAGTGG - Intergenic
1122150301 14:99721999-99722021 CTCCTCTTCCAGCAGGCGAAAGG - Exonic
1122621252 14:103058500-103058522 CTTTTCCTGGAGCTTGCGGAAGG + Intergenic
1122753044 14:103953575-103953597 CTTCTTCTCCAGCTTGCAGAAGG - Intronic
1122768653 14:104087223-104087245 CTTCTCCTTCTGCCTGTGAATGG + Intronic
1125352330 15:38780943-38780965 CTTCTCCTTCAGCTTCTGATTGG + Intergenic
1125841125 15:42802134-42802156 CTTCTCCTCCTGGGTGCGCACGG + Intronic
1128007537 15:64258053-64258075 CTTCTCATCCAGCTTGCTTGTGG - Intronic
1128368674 15:67023455-67023477 ACTCTTCTCCTGCTTGCGAAGGG + Intergenic
1131951106 15:97682913-97682935 CTTCTGCTCCAGCATTTGAAGGG - Intergenic
1132314476 15:100879975-100879997 CTTGACCTCCAGGTTGCGGATGG - Exonic
1134469913 16:14514774-14514796 CTTGTCTTCCAGCTTCCCAAGGG + Intronic
1137519437 16:49179627-49179649 CTTCTCATGCAGCTTGGAAATGG - Intergenic
1137802879 16:51277301-51277323 CTGCTTCTCCAGCTTGCCAGTGG - Intergenic
1139100816 16:63764243-63764265 CTTGTTCTCCAGCTTGCAGAGGG + Intergenic
1139696075 16:68675866-68675888 ATTCACCTCCAGCTGGTGAATGG + Intronic
1140665342 16:77222349-77222371 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
1140771302 16:78206350-78206372 CTTCTCCTCCTCCTTTCTAATGG - Intronic
1142128161 16:88420336-88420358 CTGCTCCTCCTCCTTGTGAACGG - Intergenic
1144405760 17:14951196-14951218 CAAATCCTCCAGCTTGCAAAGGG + Intergenic
1145095241 17:20019755-20019777 CTTCTCTTCCAGCTTTCCCACGG + Intronic
1145811887 17:27769247-27769269 CTCCCCCTCCAGCTGGAGAATGG + Intronic
1145993095 17:29090915-29090937 CTGCTCCTCCAGCTGGAGAGAGG + Exonic
1151383542 17:73741604-73741626 CTTCTCCTCCTGCTTGGGCAAGG - Intergenic
1151448234 17:74181272-74181294 CAGCTCCTCCAGCCTGAGAAAGG + Intergenic
1151896395 17:76983421-76983443 CTTCTCCTCCAGCCTGGAAGGGG + Intergenic
1151941798 17:77297139-77297161 CTGGGCCTCCAGCTTGCGGACGG - Intronic
1154328481 18:13409678-13409700 CTTCTCCTCCAGCTTGCGAATGG - Intronic
1154354416 18:13614148-13614170 CTTCTCCACCAGCTTCTAAATGG + Intronic
1156027963 18:32678088-32678110 CTTCTCCTACAGCTTCTGATAGG + Intronic
1157487718 18:48100443-48100465 TTCCTCCTCCAGCTTGCTAATGG + Intronic
1158006157 18:52674227-52674249 CTTGGTCTCCAGCTTGCAAATGG - Intronic
1158107524 18:53902657-53902679 GTGCTCCACCAGCTTTCGAAGGG + Intergenic
1159275318 18:66212178-66212200 CTTTTTCTCCAGCTTTCAAATGG + Intergenic
1159308125 18:66672339-66672361 CTGCTTCTCCAGCTTGCACATGG + Intergenic
1159438312 18:68446252-68446274 CTTCCCCTTCAGCTTGCAGATGG + Intergenic
1159559501 18:69978492-69978514 TTGCTCCTCAAGCTTGCGGATGG - Intergenic
1160846277 19:1167591-1167613 CCCCTCCTCCAGCTGGAGAAGGG + Intronic
1161045112 19:2130427-2130449 CTTCTCCTTCAGCCGGGGAAAGG + Exonic
1161348200 19:3778276-3778298 CTTCTCGGCCAGTTTGCGGAAGG + Exonic
1162198249 19:9002375-9002397 CTTCTTTTCCAGGTTGAGAAAGG + Intergenic
1166730749 19:45057740-45057762 CTTCTCTGCCAGCCTGAGAAAGG - Exonic
926006271 2:9375718-9375740 CTTCTCCTCCACCTGGAGATGGG - Intronic
926606562 2:14904247-14904269 CTTCTTCCCCAGCTTGCAGATGG - Intergenic
926676460 2:15626803-15626825 CTCCTCCTACAGATTGGGAAGGG + Intronic
926804045 2:16688277-16688299 CTTCTCCTCCTACTTCAGAAGGG + Intergenic
927457164 2:23262952-23262974 CTGAGCCTCCAGCTTGCAAAAGG + Intergenic
927566865 2:24121231-24121253 CTTCTCTTCGGGCTTGCAAAGGG + Exonic
927678776 2:25126119-25126141 ATTCTCCTGCGGCTTGCGCATGG + Intronic
927879396 2:26679981-26680003 CTGCTCCTCCAGCTTCTCAAGGG - Intergenic
931719493 2:65056734-65056756 CTTCGCCTCCATCTTGCGAGCGG + Intronic
931999400 2:67870389-67870411 TTTCTCCACCAGCTTGTGGATGG + Intergenic
934297198 2:91752192-91752214 CTTCTCCTGCAGCGTCCGCATGG + Intergenic
937112381 2:119376663-119376685 CTTCTCCTCCTGGTTGAGCAGGG + Intergenic
938229070 2:129642336-129642358 CTTCCCCTGCAGCTAGAGAATGG + Intergenic
941078158 2:161030060-161030082 CTTCTCCACCAGCCTGAGACAGG - Intergenic
944842379 2:203636769-203636791 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
946635103 2:221716343-221716365 AAGCTCCTCCAGCTTGAGAAGGG - Intergenic
947391152 2:229640970-229640992 CTTCTCTTCCTGCTTGCTAGTGG - Intronic
1169845416 20:9986374-9986396 CTTCTCCTACAGCTGGACAATGG - Intronic
1175124920 20:56744195-56744217 GTTCCCCTCCTGCTTGCTAAGGG + Intergenic
1176420202 21:6507997-6508019 CTTCTTCTGCAGCTTGCAGACGG + Intergenic
1177192709 21:17869589-17869611 CTGGTCCCCCAGCTTGCGGATGG - Intergenic
1179695694 21:43116317-43116339 CTTCTTCTGCAGCTTGCAGACGG + Intergenic
1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG + Exonic
1183840067 22:40492105-40492127 CTTCTCCTCCAGCATGCTGGAGG + Intronic
1184102136 22:42346431-42346453 CATCTCCTCGAGCTTGGGACTGG - Intergenic
1184585843 22:45447618-45447640 CTTCTCCTCCAGCTTCTCCATGG + Intergenic
950294593 3:11818024-11818046 TTTCTCCTCCATCTTGCCGATGG - Intronic
950680805 3:14583854-14583876 CTCCTCCTCCATCTTGGGAGGGG + Intergenic
956884893 3:73549325-73549347 CTTCTCTACCAGCTAGCAAAGGG + Intronic
961371240 3:126433282-126433304 CTTGTCCTCCATCTTCCCAAGGG - Intronic
962932395 3:140050468-140050490 CTTCTCCTTCAGCCTGGGGATGG - Intronic
963411275 3:144931181-144931203 CCTCTCCTCAAGCTTAGGAAAGG - Intergenic
964183916 3:153919894-153919916 TTTCTCCTACATCTTGCAAAAGG + Intergenic
966729762 3:183140914-183140936 CTGCTCCTCCATCTTCCCAATGG - Intronic
968273672 3:197423807-197423829 CATCTCCTCCAGCTTCTGACTGG - Intergenic
968295980 3:197576948-197576970 CTACTCCTCCAGCGTGGGGAGGG + Intergenic
968295997 3:197577017-197577039 CTACTCCTCCAGCTTGGGGAGGG + Intergenic
969119762 4:4899535-4899557 CTTCTCCTCCTGCTTGGACAAGG - Intergenic
970876789 4:20880315-20880337 CTTCTCCTCCAGGGTTGGAAAGG - Intronic
971446100 4:26750534-26750556 CTTTTCCTTCAGTTTGCTAAGGG - Intronic
973574600 4:52273979-52274001 CTTCTGCTCCAGGTTGGGGAAGG + Intergenic
978720750 4:111906112-111906134 CTCCTCCTCCAGACTGAGAAAGG + Intergenic
979859414 4:125675734-125675756 CTGCTTCTCCAGCTTGCCAATGG - Intergenic
983178288 4:164617221-164617243 TTTCTCCTACAGCTTGGGAGAGG - Intergenic
983654602 4:170070134-170070156 TTTCTCCTTCAGCTTGAGCACGG + Intronic
983819307 4:172172972-172172994 GTTCTCATCCAGCTGGGGAAAGG + Intronic
983884589 4:172966298-172966320 CTTGTCCACCAGCTTGTGGATGG - Intronic
985385828 4:189447357-189447379 CTTGTTCTCCAGCTTGCAGATGG + Intergenic
985493457 5:192173-192195 CACCACCTCCAGCTTGCGCAGGG - Exonic
986712632 5:10499121-10499143 CTTCCCCTTCAGCTTGAGACAGG - Intergenic
989318654 5:40110062-40110084 CTTCTTCTCCTGGTTGAGAAGGG - Intergenic
989955378 5:50352866-50352888 CTGGTTCTCCAGCTTGCAAATGG + Intergenic
990197383 5:53334012-53334034 CTCCTACTCCAGCTTGGGATAGG - Intergenic
992305565 5:75433764-75433786 CTTCTGCTTCAGCTTCCCAAGGG + Intronic
995682806 5:114739410-114739432 CTTTTTGTCCAGCTTGAGAAGGG - Intergenic
999395115 5:151222377-151222399 CTCCTCTTCCAGCTTGTGGAAGG + Intronic
1001264635 5:170264687-170264709 CTTCTTCTCCAGCCTCCCAAGGG - Intronic
1002174051 5:177391430-177391452 ATTCTCCTCCAGCCTTCGCAGGG + Intronic
1003619941 6:7691024-7691046 CTTCTCCTGAAGCATGTGAATGG + Intergenic
1005888005 6:30111870-30111892 TTTCCCCGCCAGCTTGAGAAAGG - Intronic
1006943631 6:37769551-37769573 CTGGTCCTCCAGCTTGCAGATGG + Intergenic
1007231578 6:40351803-40351825 CCGCACCTCCAGCTTGCAAAGGG + Intergenic
1007340386 6:41187707-41187729 CTTCTCCTTCTGCCTGTGAAAGG - Intergenic
1008757105 6:54809562-54809584 ATTCTCCTCCAGCTTCTCAAAGG + Intergenic
1009334652 6:62472169-62472191 CATCCCCACCAGCTTGCTAAAGG - Intergenic
1009371505 6:62908959-62908981 CTTGCCCCCCAGCTTGCGGATGG + Intergenic
1010467981 6:76191223-76191245 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1011390636 6:86848715-86848737 CTTCTACTGCAGCCTGCTAATGG - Intergenic
1014913687 6:127120395-127120417 CTTCTCCTGGAGCTCGCGAGGGG + Intronic
1015394871 6:132722197-132722219 CTGCATCTCCAGCTTGCAAATGG - Intergenic
1020561019 7:9728629-9728651 CTCCTCCTTCAGCTTCCCAAAGG + Intergenic
1022382804 7:29875838-29875860 AGACACCTCCAGCTTGCGAAGGG + Exonic
1024658825 7:51474238-51474260 CTTCTCCCCCATCTTGGGGAGGG + Intergenic
1029554000 7:101255052-101255074 CTTCTCCTTCTTCTTGAGAAAGG - Intergenic
1033562177 7:142543122-142543144 CTTCATCTCCAGCTTGCAGATGG - Intergenic
1033822042 7:145146754-145146776 TTTTTCCTCCAGCTTGCAGATGG + Intergenic
1035779110 8:2213432-2213454 CTTGTTCTCCAGCTTGCAGATGG + Intergenic
1040652362 8:49464107-49464129 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
1041806730 8:61859119-61859141 GATGTCCTTCAGCTTGCGAATGG + Intergenic
1043307761 8:78818312-78818334 CTGGTTCTCCAGCTTGCAAACGG - Intergenic
1049091733 8:140519868-140519890 CTGCTCCTGCAGCATGAGAAAGG - Intergenic
1050832002 9:10026225-10026247 CTCCTCCTCCAGCTAGCCAAAGG - Intronic
1051861437 9:21629247-21629269 TTTCTTCTCTAGCTTGCAAATGG + Intergenic
1052028886 9:23606065-23606087 CTTGTCCTCTAGCCTGCCAATGG + Intergenic
1052676403 9:31631031-31631053 CTTCTCTTCCACCTCGAGAATGG + Intergenic
1054877098 9:70108235-70108257 TTTCTCCCCCTGCTTGCCAAAGG - Exonic
1055223239 9:73964167-73964189 CTGGGCCTCCAGCTTGCAAATGG + Intergenic
1055710724 9:79058796-79058818 GTTCTTCTGCAGCTTGGGAAGGG - Intergenic
1056873061 9:90303197-90303219 CTTCTCCACTAGCCTGTGAAAGG - Intergenic
1057492756 9:95534610-95534632 CTTCTCCTCCTGCTTTCTAGAGG + Intergenic
1057747396 9:97762972-97762994 GATCTCATCCAGCTTGGGAAGGG - Intergenic
1059399399 9:114059475-114059497 CTTCTCCTCACCCTTGGGAAAGG - Intergenic
1185653409 X:1665714-1665736 CTTCCCCTAGAGCTTTCGAAAGG - Intergenic
1186088628 X:6019734-6019756 CTTCTCATCCAGTATGTGAAAGG - Intronic
1186283915 X:8023735-8023757 CTGGTCCTCCAGCTTGCAGATGG + Intergenic
1186451201 X:9675147-9675169 TTTCTCCAGCAGCTTGAGAAAGG + Intronic
1187914804 X:24143539-24143561 CTTGTTCTCCAGCTTGCATAAGG - Intergenic
1188248631 X:27864057-27864079 CTTCTCCTCCAGGTAGGGCAGGG + Intergenic
1188761681 X:34040197-34040219 CTTCTTCCCCAGCTTGCAGACGG + Intergenic
1189073850 X:37894963-37894985 CTGGTGCTCCAGCTTGCAAAGGG + Intronic
1189259064 X:39664874-39664896 CTTGTTCTCCAGCTTGCAGATGG - Intergenic
1193772112 X:85599950-85599972 TCTCTCCTGCAGCCTGCGAAAGG + Intergenic
1195877814 X:109560606-109560628 CTGTTCCTCCAGCTTGCAGATGG + Intergenic
1197529439 X:127605105-127605127 CTTGCCCTTCAGCTTGCGGATGG + Intergenic
1198695528 X:139332824-139332846 TTTCTCTTGCAGCTTGAGAATGG - Intergenic