ID: 1154332492

View in Genome Browser
Species Human (GRCh38)
Location 18:13441242-13441264
Sequence CACTAACACCCGAGGCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154332492_1154332497 25 Left 1154332492 18:13441242-13441264 CCTTAGAGCCTCGGGTGTTAGTG No data
Right 1154332497 18:13441290-13441312 ACCAGCCCGTTTCCTACAGCAGG No data
1154332492_1154332495 -5 Left 1154332492 18:13441242-13441264 CCTTAGAGCCTCGGGTGTTAGTG No data
Right 1154332495 18:13441260-13441282 TAGTGGATGACACTTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154332492 Original CRISPR CACTAACACCCGAGGCTCTA AGG (reversed) Intronic