ID: 1154332492

View in Genome Browser
Species Human (GRCh38)
Location 18:13441242-13441264
Sequence CACTAACACCCGAGGCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154332492_1154332497 25 Left 1154332492 18:13441242-13441264 CCTTAGAGCCTCGGGTGTTAGTG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1154332497 18:13441290-13441312 ACCAGCCCGTTTCCTACAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
1154332492_1154332495 -5 Left 1154332492 18:13441242-13441264 CCTTAGAGCCTCGGGTGTTAGTG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1154332495 18:13441260-13441282 TAGTGGATGACACTTTTTATTGG 0: 1
1: 0
2: 1
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154332492 Original CRISPR CACTAACACCCGAGGCTCTA AGG (reversed) Intronic
900376071 1:2355472-2355494 CACAGACCCCCGAGGCTCTGAGG + Intronic
902067636 1:13700844-13700866 CACATACACCCGTGGGTCTATGG - Intronic
914049688 1:144121132-144121154 CACTCACACTGGAGGGTCTACGG - Intergenic
914129494 1:144844319-144844341 CACTCACACTGGAGGGTCTACGG + Intergenic
918009045 1:180569470-180569492 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
921354945 1:214277104-214277126 CACTCCCTCCCGAGGCTCTAGGG + Intergenic
1063868960 10:10397712-10397734 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1065888167 10:30097307-30097329 CACTAATACCCCAGGCTGCAGGG - Intronic
1068525770 10:58127724-58127746 CACTCCCTCCAGAGGCTCTATGG + Intergenic
1070669291 10:78366827-78366849 TACGAACACCAGAGACTCTAAGG - Intergenic
1071404598 10:85317984-85318006 CACTCTCTCCAGAGGCTCTAGGG + Intergenic
1071931012 10:90470360-90470382 CACTCACTCAGGAGGCTCTAAGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1076610416 10:131722704-131722726 CATCAGCACCCGAGGCTCTGCGG - Intergenic
1080048623 11:27835946-27835968 CACTCTCTCCTGAGGCTCTAAGG + Intergenic
1087910953 11:103752836-103752858 CACTTACTGCAGAGGCTCTATGG - Intergenic
1088536123 11:110863635-110863657 CACTACCTCCATAGGCTCTAGGG + Intergenic
1090977063 11:131687625-131687647 CACTCCCACCCGAGGCACTTGGG - Intronic
1093801852 12:23383061-23383083 CACTCACACCCGAAGCTCTAGGG - Intergenic
1095672285 12:44875849-44875871 CAGTAAGACCCGAGACTCCATGG + Exonic
1095729673 12:45492989-45493011 CACTTTCTCCAGAGGCTCTAGGG + Intergenic
1105542586 13:21327809-21327831 CACTGACACCCCAGGCTCCTGGG - Intergenic
1126883253 15:53122229-53122251 CACTAACACATGAGGATATAGGG - Intergenic
1133198854 16:4190109-4190131 CAAGAACACCCGAGGTTCCAGGG - Exonic
1133210844 16:4262665-4262687 CACTAACCCCCGAGACTCAGCGG - Exonic
1141762172 16:86035836-86035858 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1141897897 16:86970360-86970382 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1203137529 16_KI270728v1_random:1738370-1738392 CACTCACACTGGAGGGTCTACGG + Intergenic
1143096639 17:4481761-4481783 CATTGACACCCCAGGCTATAAGG + Intronic
1144392937 17:14812871-14812893 CACTATCATCCGAGGCTGAAGGG - Intergenic
1151999217 17:77634872-77634894 CACTCCCTCTCGAGGCTCTAGGG + Intergenic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1155683789 18:28521500-28521522 CACTAACCACCTAGGGTCTATGG - Intergenic
1165283481 19:34817400-34817422 CACAAACACCCCAGGGTCTTGGG - Intergenic
1202689078 1_KI270712v1_random:73695-73717 CACTCACACTGGAGGGTCTACGG - Intergenic
933957360 2:87382406-87382428 CACTCACACTGGAGGGTCTACGG + Intergenic
934241477 2:90274302-90274324 CACTCACACTGGAGGGTCTACGG + Intergenic
934271697 2:91542382-91542404 CACTCACACTGGAGGGTCTACGG - Intergenic
937927899 2:127182064-127182086 CACTCCCACCCTAGGCTCTCAGG - Intergenic
1173163017 20:40666239-40666261 CAATAACACACGAGGCTCCTAGG + Intergenic
1175604073 20:60298283-60298305 CACTCACTCCTGAGGCTCTGGGG + Intergenic
1175630770 20:60534629-60534651 CACTCCTACCAGAGGCTCTAAGG - Intergenic
1177254614 21:18644978-18645000 CACTCCCACTGGAGGCTCTAGGG + Intergenic
1177404298 21:20645726-20645748 CACTAACAGCCGGGGCACCATGG + Intergenic
1184472803 22:44705188-44705210 CGCTCCCACCAGAGGCTCTAGGG + Intronic
1184602775 22:45553253-45553275 CCCTAACACCTCAAGCTCTATGG - Intronic
954947102 3:54435314-54435336 CACTAACACCAGAGGCACGCAGG - Intronic
967727110 3:192872254-192872276 CACTAGCTCCCTAGGGTCTAAGG + Intronic
970017629 4:11530615-11530637 CACTCCCTCCGGAGGCTCTAGGG + Intergenic
971230231 4:24795554-24795576 CGCTAACAGCCCAGGCTCCAGGG + Exonic
979847594 4:125535655-125535677 CACTCACTACCGAGGCTCTAGGG - Intergenic
983029889 4:162786596-162786618 TACTAACACCCTAGGCACTAGGG + Intergenic
1003409424 6:5850007-5850029 CACTGACACCCCAGGCTCCTGGG + Intergenic
1029507074 7:100969009-100969031 CACTCACACCTGAGACTTTATGG - Intergenic
1042516268 8:69662753-69662775 CCCTAACACCCGGGGCTTTTAGG + Intergenic
1047192370 8:122689792-122689814 GACTAACACCCCAGGATTTATGG - Intergenic
1048820349 8:138374659-138374681 AACTAAGACCGGAGGCTCTAAGG + Intronic
1053307093 9:36992429-36992451 CACTCACTCCCCAGGCTCTCGGG + Intronic
1057082289 9:92181849-92181871 CACTACCTCCAAAGGCTCTAGGG + Intergenic
1057967455 9:99517967-99517989 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1058767850 9:108199076-108199098 CACTGCCACCCGAGGCTGTGAGG - Intergenic
1188068831 X:25695011-25695033 CACCACCACCCTAGGCCCTAAGG + Intergenic
1190429561 X:50366068-50366090 CATTAAGACCCAAAGCTCTAGGG - Exonic
1190748560 X:53341514-53341536 CTCTGACACCCCAGGCTATATGG + Intergenic
1192667300 X:73101483-73101505 CACTACCACCCCAGGCCCTGAGG + Intergenic
1193656366 X:84203035-84203057 CACTAACAACTCAGGCTCAATGG - Intergenic
1196120507 X:112045381-112045403 CACTACCTCCAGAGGCTCTAGGG - Intronic
1198687671 X:139244752-139244774 CACTTCCTCCAGAGGCTCTAGGG - Intergenic
1200041660 X:153375312-153375334 CACTCCCCCCAGAGGCTCTAGGG - Intergenic
1200173524 X:154096829-154096851 CAGCAGCACCCGAGGCTCTTCGG - Intronic