ID: 1154332495

View in Genome Browser
Species Human (GRCh38)
Location 18:13441260-13441282
Sequence TAGTGGATGACACTTTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154332489_1154332495 17 Left 1154332489 18:13441220-13441242 CCTGTTAATAGCTGTGAACAAGC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1154332495 18:13441260-13441282 TAGTGGATGACACTTTTTATTGG 0: 1
1: 0
2: 1
3: 11
4: 141
1154332492_1154332495 -5 Left 1154332492 18:13441242-13441264 CCTTAGAGCCTCGGGTGTTAGTG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1154332495 18:13441260-13441282 TAGTGGATGACACTTTTTATTGG 0: 1
1: 0
2: 1
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154332495 Original CRISPR TAGTGGATGACACTTTTTAT TGG Intronic
903107596 1:21096781-21096803 TACTGGCTGAAAGTTTTTATGGG + Intronic
903401121 1:23049904-23049926 TAATGGATGATACTGTTGATGGG + Intronic
906526169 1:46494498-46494520 TAATGGATAACAGTTTGTATAGG + Intergenic
907057423 1:51383407-51383429 TTGTGGAAGACAATTTTTTTAGG + Intronic
913943416 1:125132633-125132655 GAGTGTAAGACACTTTTTAAAGG - Intergenic
915925878 1:160019262-160019284 TAATGGGGGACACTTTTAATGGG - Intergenic
917627432 1:176860249-176860271 CAGTAGATCACACTTTATATGGG + Intronic
919976266 1:202615068-202615090 TCGGGGATGACATTTGTTATTGG - Intronic
924603162 1:245509346-245509368 AAGAGGATGAGACTTTTTAAGGG + Intronic
1063143541 10:3276143-3276165 GAATGGATGCCACCTTTTATAGG + Intergenic
1063728928 10:8673071-8673093 TAGGAGATGACACTTATTTTGGG + Intergenic
1068725457 10:60296242-60296264 CAGTGGATGACACTGTCCATAGG + Intronic
1070667606 10:78356462-78356484 TGGAGGATGACACCTTCTATGGG + Intergenic
1078479855 11:11666080-11666102 TAGTGGATGCAACATTTTAATGG - Intergenic
1078544666 11:12238566-12238588 TACAGAATGACACTTTTTGTAGG - Intronic
1080018094 11:27528647-27528669 TAGTGAATTAGATTTTTTATAGG - Intergenic
1085956926 11:81409505-81409527 TCATGAATGACACTTTTTATAGG + Intergenic
1086805461 11:91236109-91236131 TTGTGGTTGCCACTTTTTTTAGG + Intergenic
1087344550 11:96954824-96954846 TAATCAATGATACTTTTTATTGG - Intergenic
1092156439 12:6284792-6284814 CAGGGGAAAACACTTTTTATAGG - Intergenic
1092962875 12:13612765-13612787 TAGTGATTGTCCCTTTTTATAGG - Intronic
1093399364 12:18725845-18725867 GAGTGGGTGACACTTTTTCAAGG - Intronic
1096691349 12:53324064-53324086 TAGTGGAAGACAGTTTTTCCAGG + Intronic
1098725011 12:73952780-73952802 TAGTGGATAACACTTTGCAATGG + Intergenic
1100028658 12:90160446-90160468 TAATGGAGCACACTTTTTAAGGG - Intergenic
1104006281 12:124894946-124894968 TATTGTATGACTCCTTTTATGGG - Intergenic
1106822962 13:33486868-33486890 TTGTGGAGGAAACTTTTTAAAGG - Intergenic
1108025018 13:46168682-46168704 TAGTAGATGACTCTCTTTCTGGG - Intronic
1109452491 13:62535622-62535644 TGTTGTATGTCACTTTTTATGGG + Intergenic
1109998109 13:70156382-70156404 TAGTGTATGAAACATTTTAGTGG - Intergenic
1111713914 13:91853283-91853305 ATGTGGATGAGACTTTTTCTTGG + Intronic
1112820927 13:103334170-103334192 TAATAGATGACACATTTTATGGG + Intergenic
1115427502 14:33277555-33277577 TAGGGGATGACATTTTTGATGGG + Intronic
1115440328 14:33426988-33427010 TGATGGATAACACTTTTTACAGG + Intronic
1116267559 14:42713452-42713474 TTGTGAATCACACTCTTTATTGG - Intergenic
1117793167 14:59362264-59362286 CACTGCATCACACTTTTTATAGG + Intronic
1117978042 14:61317834-61317856 TAGTGGATCAGACTCTTTATGGG - Intronic
1118687519 14:68305887-68305909 TGGTGGATGACTGTTTTTCTCGG + Intronic
1118967576 14:70601932-70601954 TTATGGATCACACTTTTTATTGG - Intergenic
1120396499 14:83973341-83973363 TAGGGTATGGCACTTATTATAGG + Intergenic
1120728142 14:87969461-87969483 TTGTGGAAGACACTGATTATAGG + Intronic
1124219780 15:27840486-27840508 TACTGGATTACACTTTTATTAGG - Intronic
1124230442 15:27940752-27940774 TAGTGAATGACACAGTTAATTGG - Intronic
1124491914 15:30163415-30163437 TCGGGGATGACATTTGTTATTGG - Intergenic
1124751623 15:32374902-32374924 TCGGGGATGACATTTGTTATTGG + Intergenic
1127408629 15:58681642-58681664 TAGTAGATGTAACTTTCTATTGG + Intronic
1129057300 15:72829771-72829793 TCTTGGGTGACACTTTCTATAGG + Intergenic
1129395650 15:75244312-75244334 TAGTGCATGACCCCTTTTTTTGG + Intergenic
1133309741 16:4837007-4837029 TAGATGAAGAGACTTTTTATAGG - Intronic
1135643763 16:24143491-24143513 TTGTGGATGACACTGGGTATAGG - Intronic
1138306377 16:55979969-55979991 AAGTGTATGAAAATTTTTATTGG + Intergenic
1139932759 16:70542541-70542563 TAGTTGATCACACTTCTGATGGG + Intronic
1140614413 16:76643986-76644008 TATATGAAGACACTTTTTATGGG + Intergenic
1143145867 17:4774964-4774986 AAGCAGATGCCACTTTTTATAGG + Intronic
1148201317 17:45751908-45751930 TAGAGGATTACACTGTTTCTGGG - Intergenic
1152838120 17:82548455-82548477 TAGTGAATGACCATTTTTAATGG + Intronic
1154164874 18:12007129-12007151 TATTCGATGTCACTTTTTTTTGG - Intronic
1154332495 18:13441260-13441282 TAGTGGATGACACTTTTTATTGG + Intronic
1157049244 18:44141602-44141624 AAATAGATGACACTTTGTATAGG + Intergenic
1158370941 18:56803271-56803293 TAGCAGATGACACATTTAATTGG - Intronic
1159541960 18:69789421-69789443 AAGTGGATGACCCATTATATTGG + Intronic
1165594910 19:37004645-37004667 TTCTGGATGAGACTTTTTTTGGG - Intergenic
1166073710 19:40401554-40401576 AAGGGGAGGACACTTTTTAGAGG - Intronic
1168390347 19:56001938-56001960 TACTGGCTGTCACTATTTATAGG + Intronic
925031724 2:654978-655000 GAGTGGGTGACACTTTAGATGGG + Intergenic
928622286 2:33102590-33102612 TAGTCGAAGACAATTTTTATTGG + Intronic
931029242 2:58153502-58153524 TAGTGGATGACACTGGTTTGTGG + Intronic
939621184 2:144420870-144420892 CAATGGATGGCACTTATTATCGG + Intronic
940349411 2:152665048-152665070 TAGTGGAAGACAGTTTTTCTTGG - Intronic
940504963 2:154541761-154541783 TGGTGGATGACACATTGTACAGG - Intergenic
943395371 2:187326931-187326953 AGGTGGATGACCCTTTCTATAGG + Intergenic
943762853 2:191628770-191628792 TGGAAGATGACACTTTTCATAGG + Intergenic
944905701 2:204259898-204259920 TAATGGATGATACATTTTAATGG - Intergenic
945352481 2:208798408-208798430 TAGAAGATGATACTTCTTATGGG - Intronic
946274736 2:218622603-218622625 GAGTGAATGAAACTTTTAATGGG - Intronic
946482985 2:220074534-220074556 TACTTGTTGACACTTTTTTTTGG - Intergenic
946680941 2:222215399-222215421 CAGTGGGTTACACTGTTTATAGG - Intronic
1184483227 22:44760266-44760288 GAGTGGAAGTTACTTTTTATGGG + Intronic
1184528284 22:45038547-45038569 TGGTGGATGACAGTTTCTATGGG + Intergenic
1184528306 22:45038647-45038669 TGGTGGGTGACAGTTTCTATGGG + Intergenic
949392903 3:3582540-3582562 TACTGGAGGACGCTTTTTTTTGG - Intergenic
950971424 3:17192475-17192497 TAGTGGATGCTGCTCTTTATGGG + Intronic
951257302 3:20464833-20464855 TAGCTGATAACACTGTTTATGGG + Intergenic
952187740 3:30988837-30988859 TAGGGGAGGACACGTTTTAAGGG - Intergenic
954538161 3:51376667-51376689 TAGGGGATGACAGGTTGTATTGG - Intronic
956922373 3:73943659-73943681 TAGAGAATGACATATTTTATAGG + Intergenic
958164832 3:89867211-89867233 TAGTGGATTAGTCTTTTGATGGG - Intergenic
959874328 3:111364052-111364074 TAGTATATGCCACTGTTTATTGG + Intronic
961055508 3:123785159-123785181 TAGTGGATGAGAGATTTTCTTGG - Intronic
963421864 3:145071336-145071358 TCTTGGTTGACACTTTTTAATGG - Intergenic
964201713 3:154124633-154124655 TAGTTAATGGCATTTTTTATAGG + Intronic
965080863 3:164029971-164029993 TACTTGATGACACTTTTGAGGGG - Intergenic
965250494 3:166337348-166337370 TATTGGATGAGACTTGTTTTTGG + Intergenic
971727647 4:30334366-30334388 TAGTGGATAGCACTGTTTTTAGG + Intergenic
974724888 4:65785764-65785786 AAGTGGCTGATACTTTTCATTGG + Intergenic
974967852 4:68785427-68785449 AAATGTATGACATTTTTTATAGG + Intergenic
982724100 4:158887151-158887173 TAGTGGATTAGGCTTTTCATAGG + Intronic
987312469 5:16694043-16694065 AAGTGGCTGAGTCTTTTTATGGG - Intronic
988022536 5:25640511-25640533 TATTGAATGACATTTTTTAATGG + Intergenic
989391008 5:40900596-40900618 AAGGGAATGAAACTTTTTATAGG - Intergenic
989393425 5:40926042-40926064 TGGTAGATGATACTTTTAATGGG - Intronic
990364519 5:55056278-55056300 TCGTTGGTGACACTTTCTATGGG + Intergenic
993312586 5:86354343-86354365 TATTGTATGACCCTATTTATAGG - Intergenic
993818309 5:92581241-92581263 TAGGAAATGACATTTTTTATGGG + Intergenic
994278353 5:97867534-97867556 TGGGGGATGACACTTCTAATTGG + Intergenic
994718716 5:103355134-103355156 TTGAGGATGGCACTTTTTTTAGG + Intergenic
995015884 5:107307977-107307999 TAGAGAATGACACTTTTAATGGG - Intergenic
995958479 5:117810199-117810221 GAGTGGATGACAATTTGTAGTGG + Intergenic
996679094 5:126210971-126210993 TAGTGGTTGACAATTTTGTTTGG + Intergenic
997490500 5:134271835-134271857 TTGTGGATCACATTTTTTCTGGG + Intergenic
999014152 5:148079933-148079955 TAATTAAAGACACTTTTTATTGG + Intronic
1001519434 5:172380343-172380365 GAGGGAATGACAGTTTTTATTGG + Intronic
1003378386 6:5600620-5600642 TAGTGCATGCTATTTTTTATAGG + Intronic
1009353619 6:62711588-62711610 TTGTCGATGACATATTTTATTGG - Intergenic
1009468574 6:64003553-64003575 TAGTGGATGTCTATATTTATGGG - Intronic
1009674129 6:66794940-66794962 TCGTGGAAGACATTTTTTCTAGG + Intergenic
1010495062 6:76523952-76523974 TATAGTATGACACTTTTTATTGG + Intergenic
1012932801 6:105334337-105334359 TATTAGATGCCACTTTTAATCGG + Intronic
1013481790 6:110559121-110559143 TAGTGGATGACAACATTTTTTGG + Intergenic
1013867361 6:114714864-114714886 TAGTGAAGGAGACTTTTTAAGGG - Intergenic
1015800446 6:137056355-137056377 AAGTGGCTGACTCATTTTATAGG - Intergenic
1015879648 6:137858442-137858464 CAGTGGATAACATTTTATATGGG - Intergenic
1016710393 6:147164695-147164717 GAGTTGATGAGACTTTGTATGGG + Intergenic
1018322202 6:162623313-162623335 GAATTGATGACACTTTTTAAAGG + Intronic
1019845488 7:3495654-3495676 TAGTTGGTGACAGTCTTTATGGG - Intronic
1025488964 7:61087416-61087438 GAGTGTAAGACACTTTTTAAAGG + Intergenic
1029340457 7:99939612-99939634 AAGTGGCTCACACTTTTTATTGG - Intergenic
1031202495 7:118706013-118706035 TAGTTGATGACACTTTTTACTGG + Intergenic
1038165634 8:25082814-25082836 TAGCTGTTAACACTTTTTATTGG - Intergenic
1043851020 8:85216632-85216654 TTGGGGATGACAGTTTATATAGG - Intronic
1048511947 8:135070946-135070968 TAATGGATGACATTTTTGAAAGG - Intergenic
1050655785 9:7827431-7827453 TAGAAAATGACACATTTTATTGG + Intronic
1050687052 9:8183593-8183615 TAGAGGATGACACATTTTTATGG + Intergenic
1050721596 9:8597836-8597858 TAGTGGATTATACTTGTCATAGG - Intronic
1050842891 9:10174665-10174687 TAGTTGATTTCACTTTTTTTGGG - Intronic
1053336487 9:37277846-37277868 TTGTGAATGATACTTTTTAGAGG - Intronic
1054724213 9:68634082-68634104 TAGTGATTGACACTTTACATGGG - Intergenic
1055190720 9:73520042-73520064 TAGTGGAAGATAATTTTTACTGG - Intergenic
1055193259 9:73553352-73553374 TAGTAGGTGAAATTTTTTATTGG + Intergenic
1055700267 9:78937303-78937325 CAGAGGAAAACACTTTTTATGGG - Intergenic
1059054462 9:110964808-110964830 TTTTGGAAGACACTTTTTTTTGG - Intronic
1186177690 X:6942601-6942623 AAGTGGATATCACTTTTTAGGGG - Intergenic
1186953635 X:14655960-14655982 TTGTGGATCACACTTTGAATGGG - Intronic
1187742886 X:22375308-22375330 CAGTTCATGAAACTTTTTATGGG + Intergenic
1188914977 X:35899222-35899244 TAGTGGAGGACACTTGAAATGGG + Intergenic
1189648074 X:43156117-43156139 AAGTGGATGACACTTCTTTAGGG - Intergenic
1193649435 X:84111544-84111566 TCTTGGATGGCACTTTTTAAAGG - Intronic
1194866679 X:99077626-99077648 TAGTAGAGGACACTGTTTAATGG - Intergenic
1197576917 X:128225253-128225275 TACTGGAGGACAGTTTTGATGGG - Intergenic
1198547496 X:137708206-137708228 CAGTGTATGACACTGTTAATTGG - Intergenic
1199896137 X:152129602-152129624 TAGTGCATGATGCTTTTTGTGGG + Intergenic
1202261009 Y:22970375-22970397 TTTTGGGTGACACTTTTTACTGG - Intergenic
1202413997 Y:24604116-24604138 TTTTGGGTGACACTTTTTACTGG - Intergenic
1202456787 Y:25065970-25065992 TTTTGGGTGACACTTTTTACTGG + Intergenic