ID: 1154332891

View in Genome Browser
Species Human (GRCh38)
Location 18:13444072-13444094
Sequence CAGGGTAATCAAATCGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154332891_1154332895 11 Left 1154332891 18:13444072-13444094 CCATCAACGATTTGATTACCCTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1154332895 18:13444106-13444128 ATATAGGATTTATTAACTTAAGG 0: 1
1: 0
2: 0
3: 25
4: 376
1154332891_1154332897 16 Left 1154332891 18:13444072-13444094 CCATCAACGATTTGATTACCCTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1154332897 18:13444111-13444133 GGATTTATTAACTTAAGGATGGG 0: 1
1: 0
2: 0
3: 11
4: 157
1154332891_1154332899 18 Left 1154332891 18:13444072-13444094 CCATCAACGATTTGATTACCCTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1154332899 18:13444113-13444135 ATTTATTAACTTAAGGATGGGGG 0: 1
1: 0
2: 1
3: 24
4: 250
1154332891_1154332896 15 Left 1154332891 18:13444072-13444094 CCATCAACGATTTGATTACCCTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1154332896 18:13444110-13444132 AGGATTTATTAACTTAAGGATGG 0: 1
1: 0
2: 1
3: 21
4: 266
1154332891_1154332898 17 Left 1154332891 18:13444072-13444094 CCATCAACGATTTGATTACCCTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1154332898 18:13444112-13444134 GATTTATTAACTTAAGGATGGGG 0: 1
1: 0
2: 0
3: 17
4: 207
1154332891_1154332893 -5 Left 1154332891 18:13444072-13444094 CCATCAACGATTTGATTACCCTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1154332893 18:13444090-13444112 CCCTGAAGTGTATATCATATAGG 0: 1
1: 0
2: 1
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154332891 Original CRISPR CAGGGTAATCAAATCGTTGA TGG (reversed) Intronic
909764035 1:79332157-79332179 CAGGGTAAAGAGATCCTTGAAGG - Intergenic
911034602 1:93527573-93527595 CGGGGTAATCTAATCATTTAGGG + Intronic
911061425 1:93751346-93751368 CAGGGGAACCAAATAGATGAGGG - Intronic
915847599 1:159284148-159284170 CAGGGTAATCAAAAGGTTATAGG + Intergenic
919710197 1:200719058-200719080 TAGGATAATCAACTTGTTGAAGG - Intergenic
923241731 1:232092049-232092071 CAGAGAAATCAAATCTTTAAAGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079388712 11:20002658-20002680 CTGGGAAATCCTATCGTTGAAGG + Intronic
1085232732 11:74987165-74987187 CTGGGTAACTAAATAGTTGATGG - Intergenic
1085523378 11:77150943-77150965 CAGGGTAACCCAATCCATGAAGG - Intronic
1090516594 11:127434939-127434961 CAAGCTAATCATATAGTTGAGGG + Intergenic
1093151857 12:15631114-15631136 GAGGATAATTAAATCATTGAAGG + Intronic
1098944058 12:76570963-76570985 CAGGGTAACCAAATAGTTCCAGG - Intergenic
1107422585 13:40262484-40262506 CAGGGTAGTCAGATTGTTAAGGG - Intergenic
1124367685 15:29085144-29085166 CAGGGTAACCAAATACTTGAGGG - Intronic
1132133677 15:99310253-99310275 CAGGGTAACTGAATAGTTGAAGG + Intronic
1134477786 16:14590833-14590855 GAGGGTAATCAAAATGCTGACGG + Intronic
1139036049 16:62947850-62947872 CAGGGTTATGAAAATGTTGAAGG + Intergenic
1143638792 17:8183283-8183305 CATGGTAAACAAATTGATGATGG - Intergenic
1153593230 18:6696805-6696827 CAGGATAATAAAATAATTGATGG - Intergenic
1153999804 18:10473606-10473628 CAGGGGAATCAACATGTTGAAGG - Intronic
1154332891 18:13444072-13444094 CAGGGTAATCAAATCGTTGATGG - Intronic
1156375215 18:36508756-36508778 TAGGATGATCAAATAGTTGAAGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
926386362 2:12339322-12339344 CAGAGAAATCAAAGCTTTGAAGG + Intergenic
936614925 2:114038874-114038896 CAGGCTAATTAAATGGTTCAAGG - Intergenic
1169117865 20:3077669-3077691 CAGGGTCATGAAATTGTTGCTGG - Intergenic
950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG + Intronic
951454965 3:22881056-22881078 CAGAGTAATCAAATAAATGAAGG + Intergenic
953375620 3:42426074-42426096 CAGGGTAACTAAAAAGTTGAGGG + Intergenic
956088840 3:65642179-65642201 CTGGGTAATTATCTCGTTGATGG + Intronic
957436882 3:80188770-80188792 AAGGGAAATCAACTCGTTAATGG - Intergenic
963034580 3:141014493-141014515 CAGAATAGTCAAATGGTTGATGG + Intergenic
965550405 3:169959213-169959235 CAGAGTAAATAAATTGTTGATGG - Intergenic
973916612 4:55640320-55640342 CAGGGTAATGAAATAATAGAAGG + Intergenic
975150536 4:71015930-71015952 CAGGGTAATCAGGTAGTAGAAGG + Intronic
989066714 5:37470234-37470256 CAGTGTAATTTAATCCTTGAAGG - Intronic
993251650 5:85532976-85532998 TAGGGAAATCAAATAGTTAAAGG + Intergenic
999429422 5:151512949-151512971 CAGGTTTTTCAAATCGCTGAAGG - Intronic
1001826337 5:174748606-174748628 CAGGGCAACCAAATTGTTGATGG - Intergenic
1009883446 6:69597528-69597550 CAGGGTAATTATTTTGTTGAAGG - Intergenic
1012113853 6:95268526-95268548 CAGAGTATTCAAATCCCTGAGGG - Intergenic
1018037941 6:159897752-159897774 CAGGGTAATCATTTTTTTGATGG + Intergenic
1028902571 7:96117942-96117964 CAGGGTAATCAAATGCTTTCAGG - Intergenic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1032360615 7:131251515-131251537 CAAGGTATTCAAATGGCTGATGG + Intronic
1038007654 8:23446655-23446677 AAGGATAATCAACTTGTTGAGGG + Intronic
1040948491 8:52911030-52911052 CAGGTTAAAGAAATCTTTGAGGG - Intergenic
1041048732 8:53912776-53912798 CAGGGTAACCTAATAGTTTAAGG - Intronic
1047107999 8:121756123-121756145 CAGGGTAAACAATGCGTTTAAGG + Intergenic
1048713403 8:137239568-137239590 AAGGGTAATTAAAACGTTGTTGG + Intergenic
1050602108 9:7263314-7263336 CAGAGTAATCAAATCAATCATGG - Intergenic
1050751082 9:8938142-8938164 CAGGGTAACCAATTTGTTGATGG + Intronic
1051689448 9:19694906-19694928 CAGGGAAATCAACTTGATGAGGG - Intronic
1051689628 9:19696386-19696408 CAGGGAAATCAACTTGATGAGGG + Intronic
1052957720 9:34267070-34267092 CAGGAAAATCAGATAGTTGAGGG + Intronic
1187132003 X:16512195-16512217 CTGGATAATCAAGTCGTGGATGG - Intergenic
1189012314 X:37058935-37058957 CAGGGTAATCACATGGTTTCTGG + Intergenic
1189036398 X:37497317-37497339 CAGGGTAATCACATGGTTTCTGG - Intronic
1194098405 X:89673028-89673050 CAAGGCAATCAAATGTTTGATGG + Intergenic
1195743337 X:108089277-108089299 CAGGGTAAGCAACTTGTGGACGG + Intronic
1200451427 Y:3334406-3334428 CAAGGCAATCAAATGTTTGATGG + Intergenic