ID: 1154336667

View in Genome Browser
Species Human (GRCh38)
Location 18:13471431-13471453
Sequence CTTTCGTAATGGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154336663_1154336667 6 Left 1154336663 18:13471402-13471424 CCCACTGGAAGGGATGTAGCATT 0: 1
1: 0
2: 0
3: 12
4: 229
Right 1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 152
1154336662_1154336667 7 Left 1154336662 18:13471401-13471423 CCCCACTGGAAGGGATGTAGCAT 0: 1
1: 0
2: 0
3: 25
4: 129
Right 1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 152
1154336664_1154336667 5 Left 1154336664 18:13471403-13471425 CCACTGGAAGGGATGTAGCATTG 0: 1
1: 1
2: 1
3: 17
4: 168
Right 1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154336667 Original CRISPR CTTTCGTAATGGAGAGAAGA GGG Intronic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
905034638 1:34909726-34909748 GTTTAGTAATGGAGTGAAGGTGG - Intronic
909797813 1:79765201-79765223 CTTGCATATTTGAGAGAAGATGG - Intergenic
910194419 1:84625388-84625410 CATATGTACTGGAGAGAAGAAGG - Intergenic
910996789 1:93113677-93113699 ATCTCGTAGTGGAGAGAACATGG + Intronic
911270391 1:95794718-95794740 CTTTCCTAATAGAGAGATGGAGG + Intergenic
911480863 1:98438392-98438414 ATTTCACAATGGAGGGAAGAAGG - Intergenic
911901144 1:103507094-103507116 TTTTGCTAAAGGAGAGAAGATGG - Intergenic
912865484 1:113252548-113252570 TTTTCTTAATGGAGAGCACAGGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
915239354 1:154508811-154508833 CTTTGGTAATGGGGAGCAGTTGG + Intronic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
918412011 1:184269432-184269454 CTCTCTTATTTGAGAGAAGAGGG + Intergenic
918678366 1:187319381-187319403 CTTTCTTTATGGAGTGAGGAGGG + Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920392236 1:205615001-205615023 ATTTGGTAATGTAGAGAATAAGG + Exonic
921324722 1:213979420-213979442 CTTTGGAATAGGAGAGAAGAAGG + Intergenic
924403955 1:243721675-243721697 TTTACATAATGGAGAGAAAAAGG + Intronic
1063934129 10:11059449-11059471 CTTTCCTCATGGTGAGAAAAGGG - Intronic
1066251729 10:33639671-33639693 TTTTTGAAAAGGAGAGAAGAAGG - Intergenic
1070224139 10:74483001-74483023 CTATTGGAATGGTGAGAAGAGGG - Intronic
1071032210 10:81197863-81197885 CTTTTTTAATGGAAAGAATAGGG + Intergenic
1071094804 10:81960935-81960957 TTTTGGTCATGCAGAGAAGAAGG - Intronic
1071262617 10:83934429-83934451 CTTTCTTTATGAAGAGCAGAGGG - Intergenic
1073897250 10:108176945-108176967 CTTAGGTAATACAGAGAAGATGG - Intergenic
1074736558 10:116440387-116440409 CTTTCCAAATGGAGGGAAGTGGG - Intronic
1075537091 10:123280409-123280431 CTTTCATAAGGAAAAGAAGAAGG + Intergenic
1075796687 10:125125383-125125405 CTTTCCTAAAGTTGAGAAGAGGG - Intronic
1077556776 11:3229839-3229861 CTTTCCCCATGGGGAGAAGAGGG + Intronic
1077794167 11:5473364-5473386 CTTTCATAATGAAGAAATGAAGG + Intronic
1081651818 11:44828880-44828902 GGGTCGTGATGGAGAGAAGAGGG - Intronic
1085759292 11:79227983-79228005 CATTCTTTATTGAGAGAAGAAGG + Intronic
1086928618 11:92668004-92668026 CTTTCCTAATGGAGAGCCCAAGG - Intronic
1088914194 11:114214867-114214889 TTTTCCTAAAGCAGAGAAGAAGG + Intronic
1091039958 11:132267904-132267926 CTTTCTTAATGGAGTGCATATGG + Intronic
1091155320 11:133366575-133366597 CCTTCATGATGGGGAGAAGAAGG + Intronic
1091573676 12:1713244-1713266 CTTTGGTATTTGAGAGAACAGGG + Intronic
1093327495 12:17795616-17795638 CTTTAGTAATGGAGAGAACTAGG + Intergenic
1093340897 12:17972903-17972925 CATAAGTAATGGAGAGGAGAGGG - Intergenic
1093742674 12:22706337-22706359 CCTTCTTCATGGAGAAAAGAAGG - Intergenic
1097836609 12:64279525-64279547 CTTTCATAATGGAAAAAAGGAGG + Intronic
1099068401 12:78013437-78013459 ATTTGGTAATGCAGAGATGAGGG + Intronic
1099503266 12:83440450-83440472 CTTTCATACTGGAGAGATAAAGG + Intergenic
1101171671 12:102103906-102103928 CATTCTTAATGGTGAGAAGATGG + Intronic
1105579515 13:21681555-21681577 TTTTCATTATGCAGAGAAGAAGG + Intronic
1107000004 13:35532368-35532390 TTTTTTTAATGGAGAGAAAAAGG + Intronic
1107597916 13:41982607-41982629 CTTTAGTTATGGAGATATGACGG - Intergenic
1109575262 13:64248460-64248482 TTTTGGTAATGCAGAAAAGATGG - Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1113845945 13:113391653-113391675 CTTACGTAAGGGTGACAAGAAGG - Intergenic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1123991061 15:25683681-25683703 CTTTCTTAAGGGAGTGAGGAGGG - Intronic
1126558359 15:50016347-50016369 CTTTCATAAGGGAGAACAGATGG - Intronic
1128890546 15:71328021-71328043 CTATTGTAATGGAGGAAAGAAGG - Intronic
1130315970 15:82796932-82796954 CTTTTGTAATAAAGAGAAAAAGG - Intronic
1132140031 15:99384768-99384790 CTTTCTTACTAGAGAGAAGTGGG - Intronic
1133438957 16:5804649-5804671 CTTTCACAATGGGCAGAAGAGGG - Intergenic
1133440410 16:5816391-5816413 CCTTGGTCAAGGAGAGAAGACGG - Intergenic
1134880638 16:17742783-17742805 CTTTCATTAGGGAGAGAAGAGGG - Intergenic
1151406483 17:73890424-73890446 TGTTCGTATTAGAGAGAAGATGG + Intergenic
1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG + Intronic
1155379756 18:25207094-25207116 CTTTGGAAATGCAGAGAATATGG - Intronic
1155641785 18:28026307-28026329 GTTTGGTAATGGAGAGTAAAAGG - Intronic
1158465886 18:57689537-57689559 CTTACGGAAGGGAGAGAAGTGGG - Intronic
1158831620 18:61285637-61285659 CTTTCAGAATGAACAGAAGATGG - Intergenic
1159468298 18:68813817-68813839 CTTTTGAAAGGGAGAGAAGTTGG + Intronic
1160237460 18:77097403-77097425 CTTTTGTTATGCAGAGGAGATGG - Intronic
1161596883 19:5155041-5155063 CTTTCGAGATGGAGAAAAGAGGG - Intergenic
1161878453 19:6930063-6930085 CTTTTCTAATGGAGAGCAGCCGG - Intronic
1167689043 19:50974570-50974592 CTTGCGTATAGGAGAGCAGAGGG + Intergenic
928051507 2:28001467-28001489 CTTTAGTAGTGGAGAAAATATGG + Intronic
928418874 2:31121966-31121988 CTTTTGTAAATGATAGAAGATGG - Intronic
930460918 2:51674125-51674147 CTTTCTGAATGGATAGAAGTAGG + Intergenic
935589181 2:104830089-104830111 CTCTCCTAATGGAGACAAAATGG + Intergenic
937395834 2:121533950-121533972 CTTTTGTAAAAGAGAGAAGAGGG + Intronic
938553690 2:132403656-132403678 GTTCCCCAATGGAGAGAAGATGG + Intergenic
939054226 2:137343988-137344010 ATTTCTGAATGGAGAGAAAAAGG + Intronic
941295648 2:163736141-163736163 CTGCCGTGAGGGAGAGAAGACGG + Intergenic
942967502 2:181914845-181914867 CTTTCAGAATGGAGAGAAGGAGG + Intronic
943938068 2:193950759-193950781 CTTTCATAATGAAGAAAATATGG - Intergenic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
946442148 2:219705573-219705595 CATTTTTAGTGGAGAGAAGAAGG + Intergenic
1169702124 20:8458464-8458486 CTTTCTTAATGGGTAGAAAAAGG + Intronic
1173110938 20:40189544-40189566 CTTTCTAAATGGAGACCAGATGG - Intergenic
1173567220 20:44050382-44050404 CTTTCCTAATGAAGAAAAAATGG + Intronic
1173764673 20:45596617-45596639 TTTTTGTAATGGATAGATGAAGG - Intergenic
1182173869 22:28262807-28262829 CTTTCCTTATGGGGAGAGGATGG + Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1183405927 22:37630543-37630565 CTTTGGTGATGGAGAGATCAGGG - Intronic
1183554338 22:38513509-38513531 CTTTCATCATGGTGAGGAGAAGG - Intergenic
1184654610 22:45934821-45934843 CTCTCGTCATGGAGACAAGGGGG + Intronic
1185082200 22:48715658-48715680 CTGTCCTGCTGGAGAGAAGAGGG + Intronic
949516531 3:4812554-4812576 CTATTGTAACTGAGAGAAGAGGG - Intronic
952000767 3:28783291-28783313 CTTTTGTCATGGAGAAAAGAAGG + Intergenic
952462559 3:33543840-33543862 CATTAGTAATGGTTAGAAGAAGG - Intronic
953367435 3:42358196-42358218 CTTTCTTGATGGGGAGAGGAAGG + Intergenic
953720938 3:45354719-45354741 GTTTTGTAATGGAGAGAATGTGG + Intergenic
956378535 3:68641405-68641427 CTTTTCCAATGGAGAGAAGTAGG - Intergenic
959306411 3:104671831-104671853 CTATGGTAATGGTGAGCAGATGG + Intergenic
960292027 3:115897417-115897439 TTCTCTTCATGGAGAGAAGAGGG - Intronic
960727872 3:120689245-120689267 CATTTGCAAAGGAGAGAAGAGGG + Exonic
962894408 3:139701012-139701034 CTTTCAGAAGAGAGAGAAGAGGG + Intergenic
963030155 3:140962628-140962650 TTTTCTTCATGGGGAGAAGAGGG - Intronic
963497009 3:146077563-146077585 CTTTTTAAAGGGAGAGAAGAGGG - Intronic
963757888 3:149255220-149255242 CATTCCAGATGGAGAGAAGAGGG + Intergenic
965835757 3:172850370-172850392 ATTGAGAAATGGAGAGAAGAAGG + Intergenic
966701442 3:182857007-182857029 CTTACCTAATAAAGAGAAGAGGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
970225273 4:13850932-13850954 CTTTTGTAATGAAGTCAAGAGGG - Intergenic
970425979 4:15946751-15946773 CTTACGTGATGGAGGCAAGATGG + Intergenic
971219225 4:24689706-24689728 CTTACAAAATGGAGAGAACATGG + Intergenic
971672088 4:29574721-29574743 CTTTCTTATTGGAGAGAAGAGGG + Intergenic
972069811 4:35004081-35004103 CTTTCAGAATGTAGAGAAGAAGG - Intergenic
976961400 4:90980645-90980667 ATTTTGTAATGGTGAGATGAAGG + Intronic
978671527 4:111252944-111252966 CATGCACAATGGAGAGAAGAGGG + Intergenic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
986638529 5:9849114-9849136 TTTTCACAATGGAGAGAAGGAGG - Intergenic
987666757 5:20952536-20952558 CTTTCTTAATGCAGAAAACAAGG - Intergenic
988346710 5:30046280-30046302 ATTTTTTAATGGAGAGGAGAGGG + Intergenic
988482883 5:31644298-31644320 CTTTAGAAATAGAGAAAAGATGG + Intronic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990240731 5:53813730-53813752 CTTTCCTGATGAAGAAAAGAGGG + Intergenic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
994312963 5:98298112-98298134 CTTGCTTAGTGGGGAGAAGAAGG + Intergenic
995590601 5:113695880-113695902 CTTTCCTAATGGAAAAAAGATGG + Intergenic
996339006 5:122415568-122415590 AGTTGGAAATGGAGAGAAGAGGG + Intronic
998701395 5:144704128-144704150 CTTTTATACTGGGGAGAAGATGG + Intergenic
1001084199 5:168688438-168688460 CTTTAGGAATGGATAGAAGTGGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG + Intergenic
1007248528 6:40479828-40479850 CTTGCGTGCTGGAGAGAAGGAGG - Intronic
1011813383 6:91159174-91159196 AATTCGTAAGGGAGAGAAGGTGG + Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1012949488 6:105503051-105503073 GTTTAGTAAGGGAGAGAAGAAGG - Intergenic
1014154415 6:118094190-118094212 CTTGAGTAAATGAGAGAAGATGG + Intronic
1014573187 6:123036910-123036932 CTAACGTGTTGGAGAGAAGAGGG - Intronic
1014882219 6:126737238-126737260 CTTGTGGAATGGAGAGAACAGGG - Intergenic
1015256273 6:131183048-131183070 CCTTCTTAATGGAGAGAGGCAGG + Intronic
1020828826 7:13067320-13067342 GTTTCTTAATGGAGAAAAGGGGG + Intergenic
1021210797 7:17849304-17849326 TTTTCTTAATGGAGTGAATATGG - Intronic
1021418583 7:20419144-20419166 CATTTGTAATGGAGAGGAGAAGG + Intergenic
1022171797 7:27838607-27838629 CTTGGGTACTGGAGAGAAGAGGG - Intronic
1023837483 7:44076838-44076860 CTTTCATAGAGGAGAGGAGAGGG - Intronic
1024544899 7:50508924-50508946 CTTTCTTGTTGGAGGGAAGAGGG - Intronic
1024597740 7:50954333-50954355 CTTTCTTAATGGAAAGAAACAGG + Intergenic
1027369770 7:77495665-77495687 CTTTCTTAATAAATAGAAGAGGG + Intergenic
1027691419 7:81351333-81351355 CTTACATAATGGGGAAAAGAAGG + Intergenic
1028900804 7:96098625-96098647 CTTTGGTAAAGGTGAGAAGGAGG - Intronic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1032245790 7:130210899-130210921 CTTTTGTAATAGACAGGAGAAGG - Intronic
1032757852 7:134908206-134908228 ATTTAGTCATGGAGAGAACAAGG + Intronic
1036766937 8:11555318-11555340 CTTCCCTAATGCAGAGAAGGGGG + Exonic
1039593586 8:38770739-38770761 CTTTCTTAAGGGAGAAAAAAAGG + Intronic
1042083170 8:65078048-65078070 CTTTGGTAGGGGAGAGAGGAGGG + Intergenic
1045016905 8:98008258-98008280 CTTCAGTAAAGGAGAGAAGGAGG - Intronic
1046294834 8:112203932-112203954 TTTTCGTAATGGAAAGAATTCGG - Intergenic
1048139903 8:131784132-131784154 GTTCTGAAATGGAGAGAAGAGGG + Intergenic
1048376687 8:133828718-133828740 CTTTGGTAATGGACAAAAGTGGG + Intergenic
1049616903 8:143579510-143579532 CTTTTGCAATGGAAAGAAGAGGG + Intergenic
1050876582 9:10645860-10645882 CTTTAGTATTGGAAAGAACATGG + Intergenic
1051934067 9:22422890-22422912 CTTCCCTAATGGATATAAGAAGG + Intergenic
1054751613 9:68912849-68912871 CTTTAGTCATGAAGAGAGGATGG + Intronic
1056009622 9:82313543-82313565 CTTTCTTTATGAAGAGAAAAAGG - Intergenic
1061594610 9:131620862-131620884 CTCTCGCAATGGATAAAAGATGG + Intronic
1187526839 X:20061874-20061896 CTTTCAAAATGGAGAGATCATGG + Intronic
1195000928 X:100642619-100642641 GTTTAGTAGGGGAGAGAAGAGGG - Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1198013965 X:132589752-132589774 CTTTGCTAGGGGAGAGAAGAAGG + Intergenic