ID: 1154336682

View in Genome Browser
Species Human (GRCh38)
Location 18:13471563-13471585
Sequence GAGAGTAATGCTGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154336682 Original CRISPR GAGAGTAATGCTGATGCTGC TGG Intronic
902681874 1:18049440-18049462 GATGGTGATGGTGATGCTGCTGG + Intergenic
903471491 1:23590801-23590823 CCCAGTGATGCTGATGCTGCTGG + Intronic
903909300 1:26710588-26710610 CCTAGTAATGCTGATGCTGGTGG - Intronic
904508223 1:30977446-30977468 GAGAGTAATGCAGATGTTAATGG - Intronic
904974067 1:34442573-34442595 CCAAGTGATGCTGATGCTGCTGG + Intergenic
905238092 1:36564137-36564159 CAAAGTGATACTGATGCTGCTGG - Intergenic
905868297 1:41388219-41388241 GATAGTGATGCTGATGATACTGG + Intergenic
907175709 1:52520439-52520461 CCAAGTGATGCTGATGCTGCTGG - Intronic
907858652 1:58328421-58328443 CAGAGTCAAGCCGATGCTGCTGG - Intronic
908961313 1:69699801-69699823 GAGATAAATCCTGATGCAGCCGG + Intronic
910123670 1:83817681-83817703 GAGAGTAATGATGAAGCTTAAGG - Intergenic
913682855 1:121203287-121203309 GTGAGTAATGCTGATGAGACTGG + Intronic
914034696 1:143990912-143990934 GTGAGTAATGCTGATGAGACTGG + Intergenic
914154756 1:145077056-145077078 GTGAGTAATGCTGATGAGACTGG - Intronic
914668101 1:149849322-149849344 TCAAGTAATGCTGATGCTGCTGG + Intronic
915194012 1:154175603-154175625 CCAAGTATTGCTGATGCTGCTGG + Intronic
916274899 1:162983169-162983191 CTAGGTAATGCTGATGCTGCTGG - Intergenic
916619597 1:166481948-166481970 TGGAGTGATGCTGATGCTGGCGG - Intergenic
917367017 1:174243121-174243143 GAGAGAAATGCTGCTGCAGAAGG + Intronic
917923844 1:179772449-179772471 CCCAGTGATGCTGATGCTGCTGG - Intronic
918607395 1:186444881-186444903 CCAAGTGATGCTGATGCTGCTGG - Intronic
919468679 1:197952321-197952343 CAAGGTAATGCTGATGTTGCTGG + Intergenic
920276024 1:204804935-204804957 GAGAGAAATGCAGAAGCAGCAGG + Intergenic
920470165 1:206221800-206221822 GTGAGTAATGCTGATGAGACTGG + Intronic
920763632 1:208810108-208810130 CCAGGTAATGCTGATGCTGCTGG + Intergenic
921597647 1:217072191-217072213 GACAGAGATGCTGATGCTGACGG - Intronic
923142298 1:231170925-231170947 CAGGTTGATGCTGATGCTGCAGG - Intronic
923651112 1:235874952-235874974 CCAGGTAATGCTGATGCTGCTGG - Intronic
924316825 1:242806541-242806563 CCAAGTGATGCTGATGCTGCTGG + Intergenic
1064248864 10:13691556-13691578 CCGAGTGAGGCTGATGCTGCTGG - Intronic
1068638112 10:59369998-59370020 GAGAGTAAAATTGAGGCTGCAGG + Intergenic
1069331606 10:67300017-67300039 CTAGGTAATGCTGATGCTGCTGG - Intronic
1070589402 10:77790612-77790634 GAGAGAGAGGCTGATGCAGCGGG + Intergenic
1070742675 10:78913109-78913131 CTGGGTGATGCTGATGCTGCTGG + Intergenic
1071120364 10:82269817-82269839 CCAGGTAATGCTGATGCTGCTGG + Intronic
1071416559 10:85447098-85447120 GTGGGTAATGGTGGTGCTGCAGG - Intergenic
1071831564 10:89377468-89377490 GGCAGTAATGCAAATGCTGCTGG + Intronic
1071990333 10:91095154-91095176 ACAGGTAATGCTGATGCTGCTGG - Intergenic
1072096024 10:92180786-92180808 CCAAGCAATGCTGATGCTGCTGG + Intronic
1074538417 10:114345377-114345399 GAGAATAATCCTGAAGCTGTGGG + Intronic
1075904567 10:126069815-126069837 GAGAGAAATGGTGATGATGTTGG + Intronic
1076090795 10:127683866-127683888 GATAGTGATGGTGATGCTGACGG + Intergenic
1076724630 10:132407651-132407673 GAGAGCAAGGCAGATGCAGCCGG - Intronic
1078399211 11:11009439-11009461 CCCAGTGATGCTGATGCTGCTGG + Intergenic
1079651604 11:22936134-22936156 GAGTCTGATGGTGATGCTGCAGG + Intergenic
1080521661 11:33072688-33072710 GTGAGTAATACTGCTGCTGTAGG - Exonic
1081202931 11:40239925-40239947 GCACGTGATGCTGATGCTGCTGG - Intronic
1081278062 11:41175327-41175349 GAGAGTCAAGCTTATTCTGCAGG + Intronic
1084454298 11:69258649-69258671 CCAAGTGATGCTGATGCTGCTGG - Intergenic
1084459973 11:69291462-69291484 GACGGTAATGATGATGATGCTGG - Intergenic
1085235946 11:75015590-75015612 CCAAGTAATGCCGATGCTGCAGG + Intronic
1085373002 11:76028709-76028731 GAGAGAAATGAGGAAGCTGCAGG + Intronic
1085941011 11:81207112-81207134 CAAAATAATGCTAATGCTGCTGG - Intergenic
1086279094 11:85164923-85164945 GTGGGTGGTGCTGATGCTGCTGG - Intronic
1087012164 11:93524592-93524614 GGCAGTAATGCTGCTGCTCCAGG - Intronic
1087142104 11:94774716-94774738 CCAAGCAATGCTGATGCTGCTGG + Intronic
1087184701 11:95176435-95176457 GGGAGTAAAGCTGATTATGCTGG + Intronic
1087466379 11:98511814-98511836 GAGAGGAATGGTGATGATGTTGG - Intergenic
1087760771 11:102102183-102102205 GTTAGTGATGCTGATGCTGCTGG + Intergenic
1087866242 11:103229953-103229975 CAAAGTGATGCTGATGCTGCTGG - Intronic
1088684699 11:112274872-112274894 GACAGTGATGCAGATGCTGAAGG + Intergenic
1092954922 12:13541076-13541098 AAGTGTAATTCTGATGCTGTTGG + Exonic
1093264113 12:16980578-16980600 GATAGTAATGCAGAAGATGCAGG - Intergenic
1094399858 12:30050777-30050799 GGTGGTGATGCTGATGCTGCTGG - Intergenic
1095525840 12:43124153-43124175 GACATTAATGGGGATGCTGCTGG + Intergenic
1095835106 12:46629356-46629378 GAGGGTGATGCTGATGCTGCTGG + Intergenic
1095926544 12:47584900-47584922 GAGAGTAAAACTGATGATTCAGG + Intergenic
1095981338 12:47976425-47976447 GAGGGAAATGCTGCTGCTTCTGG - Intronic
1095997140 12:48097579-48097601 CCAAGTAATGTTGATGCTGCTGG + Intronic
1096070698 12:48773996-48774018 GAGAGTAATTGAGCTGCTGCAGG + Exonic
1096701120 12:53383431-53383453 GAGAGTGGTGTTGCTGCTGCTGG - Exonic
1097674516 12:62584253-62584275 TCTGGTAATGCTGATGCTGCAGG + Intronic
1098224940 12:68311647-68311669 GAGAGAAAAGTTGATGATGCAGG - Intronic
1098690519 12:73481784-73481806 GTGAGTCTTGCTGATGCTCCCGG + Intergenic
1100231193 12:92609741-92609763 CCGGGTGATGCTGATGCTGCTGG + Intergenic
1101159280 12:101956838-101956860 CAGAGTAATGCTGAGGCTTGTGG - Intronic
1102737718 12:115178228-115178250 GAGGGTGATGCTGATGGTGATGG - Intergenic
1103248902 12:119483010-119483032 GACAGTGATGATGATGGTGCTGG + Intronic
1104524290 12:129503915-129503937 GACAGTAATGATGATGATGATGG - Intronic
1106371862 13:29142353-29142375 CTGGGTAATGCTGATGCTCCTGG + Intronic
1106537277 13:30658112-30658134 GTGAATAATACTGATGCTACTGG + Exonic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107073241 13:36294642-36294664 GTGAGTCTTGCTGATGCTCCCGG - Intronic
1108095110 13:46893397-46893419 CCGGGTGATGCTGATGCTGCTGG + Intronic
1108207403 13:48104636-48104658 CAGAGTAAAGATGATGTTGCAGG + Intergenic
1108379667 13:49843969-49843991 CTCAGTGATGCTGATGCTGCTGG - Intergenic
1110416267 13:75256548-75256570 CTAGGTAATGCTGATGCTGCTGG - Intergenic
1110634190 13:77746788-77746810 GTGAATAATACTGTTGCTGCTGG - Exonic
1110646974 13:77898317-77898339 TACAGTCATGCTTATGCTGCTGG - Exonic
1112501109 13:99943921-99943943 GAGAGAAATGCTGGTGGGGCTGG - Intergenic
1113259722 13:108548263-108548285 GAGAGTTAGGATGATGATGCTGG + Intergenic
1113757455 13:112823033-112823055 GGGAGTGTTGCTGAGGCTGCCGG + Intronic
1114366460 14:22032432-22032454 GAGAATTATGCTGATTCTCCTGG - Intergenic
1114622663 14:24106050-24106072 CTGGGTAATGCTGATGCTGCCGG + Intronic
1114768878 14:25406505-25406527 CCAAGTAATGCTGATGCTGTTGG - Intergenic
1116873755 14:50091670-50091692 GAGGGAAGTGCTGCTGCTGCCGG - Exonic
1117032886 14:51693209-51693231 GAGAATAATACTTACGCTGCAGG + Intronic
1117078616 14:52128707-52128729 GAGGGTGGTGCTGATGCTGTGGG + Intergenic
1117431692 14:55671931-55671953 CATGGTGATGCTGATGCTGCTGG - Intronic
1117690842 14:58303679-58303701 CCAAGTAAGGCTGATGCTGCTGG - Intronic
1117937506 14:60923307-60923329 CTAAGTAATGCTGATGCTGATGG + Intronic
1118470071 14:66067328-66067350 GTAGGTAATGCCGATGCTGCTGG - Intergenic
1119449437 14:74695933-74695955 ACAGGTAATGCTGATGCTGCTGG + Intronic
1119466744 14:74864163-74864185 CCAGGTAATGCTGATGCTGCTGG + Intronic
1119499839 14:75115724-75115746 CCAAGTGATGCTGATGCTGCTGG - Intronic
1120841610 14:89090406-89090428 TAGAGTAATGGTGGGGCTGCTGG - Intergenic
1121179950 14:91921521-91921543 CTGAGTGATGCTGACGCTGCTGG - Intronic
1121612003 14:95287630-95287652 CTGGGTGATGCTGATGCTGCTGG + Intronic
1121963670 14:98284597-98284619 GAGACTGCTGCTGATGCTGGTGG + Intergenic
1122201507 14:100125495-100125517 GACACTAATGTAGATGCTGCTGG + Intronic
1122213807 14:100190372-100190394 GTGAGCAATGATGATGCCGCAGG - Intergenic
1122222308 14:100247803-100247825 GAGAGGAAATATGATGCTGCTGG - Intronic
1122261646 14:100526804-100526826 GGTAGTGATGCTGATGGTGCTGG - Intronic
1125695212 15:41630825-41630847 GTGAGTACTGCTGATTCTACTGG - Intronic
1126223175 15:46239006-46239028 GATGCTGATGCTGATGCTGCTGG - Intergenic
1127039197 15:54954637-54954659 CTAAGTGATGCTGATGCTGCTGG + Intergenic
1127377555 15:58398877-58398899 CTCAGTAACGCTGATGCTGCTGG - Intronic
1128231551 15:66039002-66039024 GACAGTCCTGCTGGTGCTGCTGG - Intronic
1128485802 15:68086588-68086610 GGGAGTAATGGCGATGATGCAGG - Exonic
1129032184 15:72627509-72627531 GATGGGGATGCTGATGCTGCTGG - Intergenic
1129406950 15:75326247-75326269 GATGGTGATGCTGATGTTGCTGG - Intergenic
1129470156 15:75749117-75749139 GATGGTGATGCTGATGCTGCTGG - Intergenic
1129695058 15:77735726-77735748 CCAGGTAATGCTGATGCTGCTGG + Intronic
1129734874 15:77954025-77954047 GATGGGGATGCTGATGCTGCTGG + Intergenic
1129840717 15:78741966-78741988 GATGGGGATGCTGATGCTGCTGG - Intergenic
1130380479 15:83367925-83367947 CCCAGAAATGCTGATGCTGCTGG + Intergenic
1130636999 15:85632215-85632237 GAAGGTGATGCTGATGCTGCTGG - Intronic
1130795105 15:87199504-87199526 TATGGGAATGCTGATGCTGCTGG + Intergenic
1131079765 15:89524941-89524963 GAGAGTAAAGCTGATTCTGTAGG - Intergenic
1131439952 15:92452205-92452227 CCCAGTGATGCTGATGCTGCTGG - Intronic
1131538590 15:93257305-93257327 TCAAGTGATGCTGATGCTGCTGG - Intergenic
1131670057 15:94610347-94610369 CTGGGTGATGCTGATGCTGCTGG - Intergenic
1133732989 16:8591739-8591761 GAGAGTGGTGCTGGTGCTGGTGG - Intergenic
1133907526 16:10035658-10035680 CCAAGTGATGCTGATGCTGCTGG + Intronic
1134633845 16:15777445-15777467 CCAAGTGATGCTGATGCTGCTGG + Intronic
1134914572 16:18059153-18059175 GTGTGTTATGCTTATGCTGCAGG + Intergenic
1135941000 16:26821876-26821898 CTGAGTAATGCTGATGCTGCTGG + Intergenic
1136869278 16:33790460-33790482 GAGAAATATGCTGATGCTTCAGG - Intergenic
1137411310 16:48230512-48230534 GAGAGAAATCCTGAGGCTCCAGG - Exonic
1137604640 16:49779416-49779438 CAGGGTGATGTTGATGCTGCTGG - Intronic
1137841065 16:51641283-51641305 GACGGCAATGCTGATGCTGCAGG + Intergenic
1138029890 16:53551792-53551814 GATAGGAGTGCAGATGCTGCTGG + Intergenic
1139899849 16:70319437-70319459 GCAGGTGATGCTGATGCTGCTGG + Intronic
1140412824 16:74751729-74751751 GAGAGAAATGCCTATGGTGCTGG + Intronic
1141238661 16:82244154-82244176 CTAAGTGATGCTGATGCTGCTGG + Intergenic
1141319783 16:82996707-82996729 GAGAGTGATGATGATGATGATGG + Intronic
1141377261 16:83542979-83543001 GCAAGTGATACTGATGCTGCTGG + Intronic
1141513980 16:84530846-84530868 GAGGGTGATGCTAATGCTCCTGG - Intronic
1141708372 16:85682703-85682725 GAGAACAGTGCTGATGCTGGTGG - Intronic
1203102895 16_KI270728v1_random:1325608-1325630 GAGAAATATGCTGATGCTTCAGG + Intergenic
1142930663 17:3281528-3281550 TTGAAAAATGCTGATGCTGCCGG - Intergenic
1143252771 17:5535322-5535344 GAGGGTGATGCTCATGCTGCTGG + Intronic
1144017081 17:11206516-11206538 AAGAGTGATACTGATGCTGACGG - Intergenic
1144194241 17:12875206-12875228 CAAAGTGATGCTGATGCTGCTGG + Intronic
1144797402 17:17901555-17901577 GAGAGTAGTCCTGAAGCTGAAGG - Intronic
1146439799 17:32883900-32883922 CCAAGTGATGCTGATGCTGCTGG + Intergenic
1146569774 17:33942253-33942275 AATAGTGATGCTGCTGCTGCAGG - Intronic
1149189504 17:54042562-54042584 TCCAGCAATGCTGATGCTGCCGG + Intergenic
1149269997 17:54967665-54967687 CCGGGTGATGCTGATGCTGCCGG + Intronic
1150748062 17:67832691-67832713 GGGAGTGATGCTGACGGTGCGGG - Intronic
1151367101 17:73624692-73624714 CTGAGTGATGCTGAGGCTGCCGG + Intronic
1152178849 17:78805391-78805413 GAGAGTAAGGCAGAGGCTGTGGG + Intronic
1152283333 17:79398172-79398194 GAGAGCAGTCCTGATCCTGCTGG + Intronic
1153689132 18:7573925-7573947 CAATGTAATGCTGATGCTGCTGG - Intronic
1154336682 18:13471563-13471585 GAGAGTAATGCTGATGCTGCTGG + Intronic
1155594430 18:27468554-27468576 GAGAGACATGATGATGCTTCAGG + Intergenic
1155977518 18:32146536-32146558 CCAAGTAATGCTGATGCTGCTGG - Intronic
1156367181 18:36440162-36440184 CCAAGTGATGCTGATGCTGCTGG + Intronic
1156420397 18:36946432-36946454 CTGAGTAATGCTGATGTTGCTGG - Intronic
1157710433 18:49846350-49846372 GATGCTGATGCTGATGCTGCTGG + Intronic
1158207297 18:55007555-55007577 GAAAGTAAGGCAGGTGCTGCTGG - Intergenic
1158312470 18:56172965-56172987 CCAGGTAATGCTGATGCTGCTGG + Intergenic
1159873760 18:73787734-73787756 GAGAGTGAAGCTGAATCTGCAGG - Intergenic
1163616854 19:18334285-18334307 GAATCTAATGCTGCTGCTGCTGG - Intergenic
1164999510 19:32749420-32749442 GGCAGTGATGCTGCTGCTGCGGG + Intronic
1165324365 19:35105662-35105684 GATGGTGATGCTGATGCTGGTGG - Intergenic
1165324391 19:35105859-35105881 GATAGTAATGATGATGATGGTGG - Intergenic
1165610631 19:37149214-37149236 GAGAGGAATGCTGATAATGTGGG + Exonic
1166164313 19:40976546-40976568 CAAGGTGATGCTGATGCTGCAGG + Intergenic
1166186463 19:41142476-41142498 CAAGGTGATGCTGATGCTGCAGG - Intergenic
1166318496 19:42002372-42002394 GAGAGGACAACTGATGCTGCAGG + Intronic
1168427411 19:56249882-56249904 TTCAGTGATGCTGATGCTGCTGG + Intronic
926132420 2:10312459-10312481 GACAGTAATGATGATGGTGATGG - Intronic
926761812 2:16284868-16284890 GAGGGTGATGTTAATGCTGCTGG - Intergenic
927436169 2:23068386-23068408 CCAAGTAATGTTGATGCTGCTGG - Intergenic
927864057 2:26577521-26577543 GATAGTACTTCCGATGCTGCTGG - Exonic
928273292 2:29876552-29876574 GATGGTAATGATGATGCTGATGG + Intronic
929615483 2:43303928-43303950 CCAGGTAATGCTGATGCTGCTGG + Intronic
929875265 2:45791464-45791486 CAGTGTAATGCTGAGCCTGCTGG - Intronic
930099593 2:47592678-47592700 CAGGGTAATTCTGCTGCTGCAGG + Intergenic
930590616 2:53322413-53322435 GCATGTGATGCTGATGCTGCTGG - Intergenic
930605577 2:53489732-53489754 CAAGGTAATGCTGAGGCTGCTGG + Intergenic
931706255 2:64948802-64948824 CCAAGTGATGCTGATGCTGCTGG - Intergenic
931731145 2:65154478-65154500 CCAAGTGATGCTGATGCTGCTGG - Intergenic
934628909 2:95893370-95893392 TTGGGTGATGCTGATGCTGCTGG - Intronic
934629039 2:95895239-95895261 TTGGGTTATGCTGATGCTGCTGG - Intronic
934629184 2:95897107-95897129 GTGGGTGATGATGATGCTGCTGG - Intronic
934629318 2:95898982-95899004 TTGGGTGATGCTGATGCTGCTGG - Intronic
934629453 2:95900855-95900877 TTGGGTTATGCTGATGCTGCTGG - Intronic
934629733 2:95904598-95904620 TTGGGTGATGCTGATGCTGCTGG - Intronic
934629868 2:95906471-95906493 TTGGGTTATGCTGATGCTGCTGG - Intronic
934630144 2:95910210-95910232 TTGGGTGATGCTGATGCTGCTGG - Intronic
934630273 2:95912084-95912106 TTGGGTTATGCTGATGCTGCTGG - Intronic
934630416 2:95913945-95913967 TTGGGTGATGCTGATGCTGCTGG - Intronic
934802952 2:97185652-97185674 TCGGGTGATGCTGATGCTGCTGG + Intronic
934803492 2:97193194-97193216 TTGGGTGATGCTGATGCTGCTGG + Intronic
934803784 2:97196929-97196951 TTGGGTGATGCTGATGCTGCTGG + Intronic
934803919 2:97198799-97198821 TTGGGTGATGCTGATGCTGCTGG + Intronic
934804200 2:97202534-97202556 TTGGGTGATGCTGATGCTGCTGG + Intronic
934804335 2:97204404-97204426 TTGGGTGATGCTGATGCTGCTGG + Intronic
934804476 2:97206276-97206298 TTGGGTGATGCTGATGCTGCTGG + Intronic
934804610 2:97208147-97208169 TTGGGTGATGCTGATGCTGCTGG + Intronic
934832861 2:97549244-97549266 GATGCTGATGCTGATGCTGCTGG - Intronic
934833247 2:97554895-97554917 TCGGGTGATGCTGATGCTGCTGG - Intronic
936974736 2:118207756-118207778 CAGAGCAATGCAGATACTGCTGG + Intergenic
938239881 2:129735314-129735336 GACAGTAATGGTGATGGTGGTGG + Intergenic
938542538 2:132296421-132296443 GAGAGTGATGCTGGTGGTGCTGG - Intergenic
938904063 2:135822431-135822453 GATGCTAATGTTGATGCTGCTGG + Intronic
939113895 2:138039101-138039123 GCAAATTATGCTGATGCTGCTGG + Intergenic
939643868 2:144672500-144672522 GAGAATGATGATGATGATGCAGG + Intergenic
940567722 2:155389276-155389298 GTAAGAATTGCTGATGCTGCAGG + Intergenic
940733534 2:157422043-157422065 CTGAGAAAAGCTGATGCTGCTGG + Intronic
941906830 2:170724766-170724788 CCAAGTGATGCTGATGCTGCAGG - Intergenic
942286010 2:174416707-174416729 TAGAATAAAGCTGATGCTGTTGG + Intronic
943046359 2:182866513-182866535 GGGAGGGATGCTGCTGCTGCGGG - Exonic
945435823 2:209816624-209816646 CCAAGTGATGCTGATGCTGCTGG + Intronic
945860293 2:215113523-215113545 GTAAGTGATGCTGATGCAGCTGG + Intronic
947094746 2:226553276-226553298 GAGAGAGATGCTGATGAAGCTGG - Intergenic
948698243 2:239744883-239744905 GAGAGTCAGGCTGAGGCTGTGGG + Intergenic
948708455 2:239810390-239810412 CCAAGTGATGCTGATGCTGCTGG + Intergenic
948715561 2:239858924-239858946 GAGTGCATTGCTGATGGTGCCGG + Intergenic
1168912464 20:1460268-1460290 CACTGTAATGCTGATGCTCCTGG - Intronic
1169288961 20:4332487-4332509 GGGAGTGATGTTGGTGCTGCTGG - Intergenic
1169816357 20:9660914-9660936 CCCAGTGATGCTGATGCTGCTGG - Intronic
1169934770 20:10871552-10871574 CTGAGAGATGCTGATGCTGCTGG + Intergenic
1170091673 20:12596076-12596098 TCCAGTGATGCTGATGCTGCTGG + Intergenic
1170412287 20:16104632-16104654 GACGGTTATGCTGATACTGCTGG - Intergenic
1170849349 20:19990250-19990272 GAAGGTCATGCTGCTGCTGCGGG + Exonic
1171286430 20:23942844-23942866 GAGAATAATGATGGTGCTGGTGG - Intergenic
1171427038 20:25055670-25055692 TCAGGTAATGCTGATGCTGCAGG + Intronic
1171871418 20:30529268-30529290 GAGAGTGATGCTGGTGACGCTGG - Intergenic
1172045832 20:32079631-32079653 TTGAGTAAAACTGATGCTGCAGG + Intronic
1172642136 20:36446905-36446927 GCGACTATTGCTGAGGCTGCCGG - Exonic
1173026209 20:39309811-39309833 CTGAGTGATGCTAATGCTGCTGG + Intergenic
1173395322 20:42673794-42673816 TATAGCAATACTGATGCTGCTGG + Intronic
1174530526 20:51209263-51209285 CAGGGTGAAGCTGATGCTGCTGG - Intergenic
1175506347 20:59487660-59487682 GAGACTAATGATAAGGCTGCAGG - Intergenic
1175597858 20:60249743-60249765 CCCAGTGATGCTGATGCTGCTGG + Intergenic
1175671403 20:60906107-60906129 AAGAGAAATGATGATGCTGCTGG + Intergenic
1177157838 21:17516502-17516524 CTAAGTAATGCTGACGCTGCAGG - Intronic
1178489446 21:33039664-33039686 GAGAACAATGTTGAGGCTGCTGG + Intergenic
1178746229 21:35252937-35252959 TTCAGTAATGCTGATGCTGCCGG - Intronic
1179024988 21:37672463-37672485 GAGAGGACTTCCGATGCTGCCGG - Intronic
1181300116 22:21873906-21873928 GTGAATAATGCTGATGCTGCTGG - Intergenic
1181856785 22:25787401-25787423 CACAGCAATGCTGATGCTGCTGG + Intronic
1182084241 22:27550649-27550671 GGGAGTCATCCTGAAGCTGCAGG - Intergenic
1183098094 22:35566491-35566513 CAAGGTGATGCTGATGCTGCTGG + Intergenic
1183322503 22:37173714-37173736 GTGGTTAATGCTGAGGCTGCTGG - Intronic
1183566859 22:38621792-38621814 TGGAGAGATGCTGATGCTGCAGG + Intronic
949744303 3:7270641-7270663 TACAGTTATGCTGAAGCTGCTGG - Intronic
949830000 3:8204110-8204132 CTGGGTAATGCTGATGCTGCTGG + Intergenic
949968558 3:9381473-9381495 CAGGACAATGCTGATGCTGCTGG + Intronic
950010097 3:9716886-9716908 CCAAGTAATGCTGATGCTGCTGG - Intronic
951040906 3:17988041-17988063 CCGCGTGATGCTGATGCTGCTGG + Intronic
951372419 3:21866635-21866657 CCAGGTAATGCTGATGCTGCTGG + Intronic
951689573 3:25381711-25381733 CCAGGTAATGCTGATGCTGCTGG - Intronic
951740965 3:25923007-25923029 TCCAGTAATGCTGATTCTGCTGG - Intergenic
952187348 3:30984375-30984397 CTGAGTGACGCTGATGCTGCTGG + Intergenic
952576553 3:34781128-34781150 CTGGGTGATGCTGATGCTGCTGG + Intergenic
952991210 3:38832567-38832589 CAAGGTGATGCTGATGCTGCTGG - Intergenic
954718700 3:52541384-52541406 GAGAATAAAGCTGATGCTTAAGG + Exonic
955305993 3:57832677-57832699 GATGATAATGCTGATGATGCTGG + Intronic
955661827 3:61307665-61307687 CCAGGTAATGCTGATGCTGCTGG - Intergenic
957139342 3:76333038-76333060 GCAGGTAATGCTGTTGCTGCAGG + Intronic
957337986 3:78857568-78857590 GATGCTGATGCTGATGCTGCTGG - Intronic
958020077 3:87983878-87983900 GAGAGTAGTGCTGCTGCTCCAGG - Intergenic
959825919 3:110795554-110795576 CCAAGTACTGCTGATGCTGCAGG + Intergenic
960630755 3:119728275-119728297 CAAGGTAATGTTGATGCTGCTGG - Intronic
961660423 3:128465869-128465891 GACAGTAATGGTGATGATGAAGG + Exonic
961960125 3:130845878-130845900 TCCAGTGATGCTGATGCTGCTGG - Intergenic
962016512 3:131446141-131446163 GCAGGTGATGCTGATGCTGCTGG - Intergenic
962648443 3:137463785-137463807 GAGGGTAATGCTGAGTTTGCTGG + Intergenic
963056145 3:141188017-141188039 CTGAGTAATGCTTCTGCTGCAGG + Intergenic
963690540 3:148495783-148495805 CTAAGTGATGCTGATGCTGCAGG + Intergenic
963756750 3:149242491-149242513 CCAAGTGATGCTGATGCTGCTGG + Intergenic
964120771 3:153180732-153180754 CAAAGTGCTGCTGATGCTGCTGG - Intergenic
964941965 3:162169360-162169382 GAGAGCACTTCTGAAGCTGCAGG + Intergenic
965507464 3:169532265-169532287 AAGGCTGATGCTGATGCTGCTGG + Intronic
966475529 3:180340571-180340593 GTGAGTGATACTGATGCTACTGG - Intergenic
967093437 3:186154796-186154818 CAAGGTGATGCTGATGCTGCTGG - Intronic
967328450 3:188266178-188266200 GGGAGTGCTGCTGCTGCTGCTGG - Intronic
967434088 3:189424555-189424577 CAGGGTGATGCTGATGTTGCCGG - Intergenic
968590023 4:1453233-1453255 GGTAGTAATGCTGGTGTTGCTGG - Intergenic
969628514 4:8321284-8321306 GAGGGTAATGGTGATGATGATGG - Intergenic
969628530 4:8321401-8321423 GACAGTAATGGTGATGATGATGG - Intergenic
969954727 4:10877175-10877197 CCAAGTGATGCTGATGCTGCTGG - Intergenic
970814603 4:20139122-20139144 TGGAGTGATGCTGATGCTGCTGG - Intergenic
970873876 4:20847355-20847377 CAAGGTGATGCTGATGCTGCTGG - Intronic
971745755 4:30578016-30578038 GAGAGTGAGGTTGATGCTGTAGG - Intergenic
972213086 4:36862233-36862255 TATAGCAATGCTGATGCTCCAGG + Intergenic
975442214 4:74424063-74424085 GAGAGTCAGACTGATGCTGTTGG + Intergenic
975782789 4:77857546-77857568 AACAGTGATGTTGATGCTGCTGG - Intergenic
975995581 4:80309959-80309981 CCAAGTAATGCTGTTGCTGCTGG - Intronic
978659847 4:111112240-111112262 GAGAGGAAAGCTGAGGGTGCCGG - Intergenic
981001695 4:139834595-139834617 CAAAGTGATGCTGATGCTGATGG + Intronic
983121222 4:163887467-163887489 GATAATTATGCTGGTGCTGCTGG - Intronic
983823394 4:172225821-172225843 CCAGGTAATGCTGATGCTGCTGG + Intronic
985711119 5:1430531-1430553 GAAAGTAGGGCTGATGCTGCCGG - Intronic
988058417 5:26132849-26132871 TAGAGTAAAGCTGAAGCAGCAGG + Intergenic
988706878 5:33735307-33735329 CAGGGTGATGCTGATGCTGCTGG + Intronic
989108683 5:37886865-37886887 CCATGTAATGCTGATGCTGCTGG - Intergenic
989200616 5:38759069-38759091 GATCCTCATGCTGATGCTGCGGG - Intergenic
990474479 5:56148778-56148800 GAGAGAAATGTTGATGTGGCTGG + Intronic
991035609 5:62124562-62124584 CTGAGCAATGGTGATGCTGCGGG - Intergenic
992018639 5:72600417-72600439 GAGAATAATTTTGATGCTGGTGG - Intergenic
992890040 5:81195643-81195665 CCGGGTGATGCTGATGCTGCTGG - Intronic
992948453 5:81832835-81832857 CAAGGTAATGCTGATGCAGCGGG + Intergenic
993054273 5:82964077-82964099 GACAGTAATGTTTACGCTGCAGG + Intergenic
993405079 5:87501305-87501327 GACAGAAATGCTGATGGAGCTGG + Intergenic
993927630 5:93890368-93890390 GAAAGTAATTCTGTTGCTGCTGG - Intronic
995199693 5:109412310-109412332 CTAAGTAATGCTGATGCTGTTGG - Intergenic
995385998 5:111589627-111589649 GCAAGTGATGCTGATGCTGCTGG - Intergenic
995870438 5:116738514-116738536 GAGACTATAGCTGATGCTGCTGG + Intergenic
996087818 5:119322265-119322287 GTGAGCACTGCTGATGGTGCTGG - Intronic
996588547 5:125119325-125119347 CCAAGTGATGCTGATGCTGCTGG - Intergenic
996894661 5:128465836-128465858 CAAAGTGATGCTGTTGCTGCTGG - Intronic
998151187 5:139758480-139758502 GAAAGTAATCCTGAGGGTGCTGG + Intergenic
999417289 5:151409587-151409609 CTAGGTAATGCTGATGCTGCTGG - Intergenic
1000719034 5:164682607-164682629 GACAGTCTTGCTGATGCTGACGG - Intergenic
1000931762 5:167261061-167261083 CCAAGTAATGCTGATGCAGCTGG - Intergenic
1001687529 5:173605337-173605359 CAGGGTGATGCTGATACTGCTGG + Intergenic
1002087385 5:176784732-176784754 GAGAGGAAGGCTGCTGCTGGGGG + Intergenic
1003120588 6:3316116-3316138 CCAAGTGATGCTGATGCTGCTGG + Intronic
1003251228 6:4430691-4430713 TAGGGTGATGCTGATGCTGCTGG - Intergenic
1003328537 6:5110873-5110895 GCAGGTAATGCTGATGCTGCTGG + Intronic
1003340063 6:5212094-5212116 CTCAGTGATGCTGATGCTGCAGG + Intronic
1003826707 6:9960825-9960847 GCAGGTGATGCTGATGCTGCTGG + Intronic
1004003287 6:11615354-11615376 CAGAGGGATGCTAATGCTGCCGG - Intergenic
1004497521 6:16178815-16178837 GAAAGTAATGTTGATGCTAAAGG + Intergenic
1004525091 6:16399992-16400014 CCTAGTGATGCTGATGCTGCTGG - Intronic
1005061973 6:21785044-21785066 GCAAGTGATGCTGATGCTGCTGG - Intergenic
1005148558 6:22721337-22721359 CACAGTTATGCTGATGCTGCTGG + Intergenic
1005472084 6:26171648-26171670 GCAGGTGATGCTGATGCTGCTGG + Intergenic
1006751723 6:36382394-36382416 CTGGGTAATGCTGATGCTGCTGG - Intronic
1007034263 6:38658521-38658543 CTAAGTGATGCTGATGCTGCTGG - Intergenic
1007115819 6:39342707-39342729 GACAGTGTTGCTGAGGCTGCTGG + Intronic
1007167382 6:39838378-39838400 CCGGGTGATGCTGATGCTGCTGG + Intronic
1007212707 6:40208349-40208371 CTGAGCGATGCTGATGCTGCTGG - Intergenic
1007340106 6:41185983-41186005 GAGAGTTCTGCTGGTGCTCCTGG - Intergenic
1008670295 6:53761421-53761443 CATGGTGATGCTGATGCTGCTGG + Intergenic
1009774392 6:68186892-68186914 GAGACAAAGGCTGATGATGCAGG + Intergenic
1009923865 6:70096793-70096815 TGCAGTAATGCTGATGCTGCTGG - Intronic
1011749337 6:90439475-90439497 GTGAGTGGTGCTGATGCAGCTGG + Intergenic
1013499175 6:110730722-110730744 TTAGGTAATGCTGATGCTGCTGG - Intronic
1013765428 6:113568795-113568817 CCAAGTGATGCTGATGCTGCTGG + Intergenic
1014284508 6:119481507-119481529 CTGAGTGACGCTGATGCTGCTGG - Intergenic
1014677740 6:124388432-124388454 ACTGGTAATGCTGATGCTGCTGG + Intronic
1015674599 6:135730572-135730594 CCGAGTGATACTGATGCTGCTGG + Intergenic
1016500057 6:144710328-144710350 GCTAGTGATGTTGATGCTGCTGG + Intronic
1016884926 6:148950261-148950283 TCGGGTGATGCTGATGCTGCAGG + Intronic
1017369228 6:153685113-153685135 GACAGTGATGCTGATGGTGATGG + Intergenic
1018736297 6:166689331-166689353 GAGAGTTCTGCTAACGCTGCAGG - Intronic
1019137851 6:169922369-169922391 GAGAGTGATACTGATGCCACAGG + Intergenic
1021556204 7:21921075-21921097 GGGACTAATGCAGTTGCTGCTGG - Intronic
1021813045 7:24422559-24422581 TAGCTTAATGCTGATGCTGGTGG + Intergenic
1021952527 7:25789381-25789403 CAAGGTGATGCTGATGCTGCTGG - Intergenic
1022501624 7:30885642-30885664 TCCAGTGATGCTGATGCTGCTGG + Intronic
1022826302 7:34017765-34017787 CCAAGTAATGCTGAGGCTGCTGG + Intronic
1022956691 7:35387326-35387348 GAGGGTAATCCTGCTGCTTCTGG + Intergenic
1024245237 7:47464658-47464680 CAGGTTTATGCTGATGCTGCTGG + Intronic
1027775108 7:82455151-82455173 GAAAGTGATACTGATTCTGCTGG + Intergenic
1028144083 7:87302750-87302772 CCAAGCAATGCTGATGCTGCAGG - Intergenic
1028510069 7:91614736-91614758 GAGAGGAATGCTGATCCAGTTGG - Intergenic
1028525950 7:91786889-91786911 GAGAGAAATGCTGTTCCTGCAGG - Intronic
1028838491 7:95400328-95400350 GCAGGTGATGCTGATGCTGCTGG + Intergenic
1030674383 7:112369319-112369341 GAGTGTTATGGTGATGCTTCAGG + Intergenic
1031014547 7:116558791-116558813 CCAAGTGATGCTGATGCTGCTGG + Intronic
1031713027 7:125073041-125073063 GTGATTGATGTTGATGCTGCTGG - Intergenic
1032257068 7:130305940-130305962 GCCAGGAATGCTGATGGTGCCGG + Intronic
1032609440 7:133396066-133396088 CTAAGTGATGCTGATGCTGCTGG - Intronic
1032742884 7:134757162-134757184 GAGAATAATGTTTATGCTTCAGG - Intronic
1033988938 7:147260847-147260869 TAAAGTAATACTGATGCAGCTGG - Intronic
1035015740 7:155764286-155764308 GAGAGCACAGCAGATGCTGCTGG - Intronic
1035327559 7:158074798-158074820 ACGAGCAATGCTGATCCTGCTGG - Intronic
1037713138 8:21371596-21371618 CTGGGTGATGCTGATGCTGCAGG - Intergenic
1038411061 8:27360365-27360387 GAAAGTCATGCTGATGCTGATGG + Intronic
1038951224 8:32416521-32416543 TCAAGTAATGCTGATTCTGCTGG - Intronic
1039335149 8:36581037-36581059 TAAGGTAATGCTGATGCTGCTGG - Intergenic
1040575527 8:48648041-48648063 GAGAGTAATGCCGAGACTGGAGG - Intergenic
1041683702 8:60622316-60622338 GAGAGTACTGCTGAATCTTCAGG - Exonic
1043133162 8:76487547-76487569 CAGGGTGATGCTGAGGCTGCTGG + Intergenic
1043323808 8:79025017-79025039 CAGGGTGATGCTGATGCTGCTGG - Intergenic
1044331172 8:90921751-90921773 CAAAGTAATGTTGATGCTGAAGG - Intronic
1044644964 8:94430584-94430606 TCAAGTGATGCTGATGCTGCTGG + Intronic
1045438701 8:102189176-102189198 CACGGTGATGCTGATGCTGCTGG + Intergenic
1045549302 8:103155881-103155903 CCAAGTGATGCTGATGCTGCTGG + Intronic
1045848468 8:106664383-106664405 TTAAGTAATGCTGATGCTGCTGG + Intronic
1046731083 8:117727167-117727189 GCAGGTGATGCTGATGCTGCTGG + Intergenic
1047058035 8:121189829-121189851 CAGAGAAATGCTGATGATGATGG - Intergenic
1047774303 8:128056860-128056882 GAGAGTAAAGAAGATACTGCTGG - Intergenic
1047844149 8:128787948-128787970 GAAAGTAATGCAGATGAGGCTGG - Intergenic
1048185556 8:132237242-132237264 AAGAGTAATGATGATGATGATGG + Intronic
1049914773 9:306751-306773 CTAAGTGATGCTGATGCTGCTGG + Intronic
1051125580 9:13800871-13800893 CGGGGTGATGCTGATGCTGCTGG - Intergenic
1051279135 9:15423540-15423562 CTGAGTAATGGTGAAGCTGCGGG + Intronic
1051607277 9:18928235-18928257 GGGAGTAAAGCTGATGGTGTAGG + Exonic
1051708355 9:19904135-19904157 TCAAGTGATGCTGATGCTGCTGG - Intergenic
1051777446 9:20651397-20651419 TCAGGTAATGCTGATGCTGCTGG + Intergenic
1053900601 9:42792379-42792401 GGGAGTCATCCTGATGCTACAGG + Intergenic
1054261043 9:62865241-62865263 GGGAGTCATCCTGATGCTACAGG - Intergenic
1055468394 9:76588009-76588031 GATAGTTATGCTGATGTTACTGG + Intergenic
1055472047 9:76621642-76621664 CCCAGTGATGCTGATGCTGCTGG - Intronic
1055868198 9:80841326-80841348 CGAAGTGATGCTGATGCTGCTGG - Intergenic
1055998585 9:82190131-82190153 GAGAGTAATGGATATGCTGGAGG + Intergenic
1057148007 9:92771343-92771365 GACAGTAATGATGATGTGGCAGG + Intergenic
1057265555 9:93615141-93615163 GATAGTAATGGTGATGATGATGG + Intronic
1057265565 9:93615219-93615241 GATAGTAATGGTGATGGTGATGG + Intronic
1057266920 9:93623274-93623296 GTGAGTAATGATGGTGCTGAAGG + Intronic
1057784193 9:98074323-98074345 GAGAGGAGTGCTGAGGCTGCCGG + Intronic
1058000173 9:99856831-99856853 CCCAGTGATGCTGATGCTGCTGG + Intronic
1058551461 9:106119951-106119973 AAATGTAATGATGATGCTGCTGG + Intergenic
1058924914 9:109653694-109653716 GGAGGTGATGCTGATGCTGCTGG + Intronic
1060211345 9:121712383-121712405 GGGAGCAATGCTTATGCAGCAGG + Intronic
1060717626 9:125948154-125948176 CAGATTAATGCTGATGCTGATGG + Intronic
1185844675 X:3426879-3426901 GATAGTAATGGTGATGATGGTGG + Intergenic
1185946136 X:4378816-4378838 GAGAGCAAAGCTGAGGCTGCTGG - Intergenic
1186764931 X:12761066-12761088 TCAAGTGATGCTGATGCTGCTGG + Intergenic
1186958217 X:14706193-14706215 GTAGGTGATGCTGATGCTGCTGG - Intronic
1186996406 X:15128232-15128254 GCTGGTGATGCTGATGCTGCTGG - Intergenic
1187420684 X:19131067-19131089 TTGAGCAATGCTGATGCTGCTGG + Intergenic
1187562466 X:20415523-20415545 CCCAGTGATGCTGATGCTGCAGG - Intergenic
1187617543 X:21013943-21013965 GATGCTGATGCTGATGCTGCTGG + Intergenic
1187744765 X:22396901-22396923 CCAAGTGATGCTGATGCTGCTGG - Intergenic
1187799969 X:23050676-23050698 CCAAGTAATGCTTATGCTGCTGG + Intergenic
1188517415 X:31002538-31002560 CCAAGTAATGCTAATGCTGCTGG - Intergenic
1188613291 X:32125899-32125921 ATAAGTGATGCTGATGCTGCTGG - Intronic
1189023364 X:37365761-37365783 GAAAATAATGCTGTTGCTTCTGG - Intronic
1189219430 X:39358466-39358488 CCAAGTGATGCTGATGCTGCTGG + Intergenic
1190161968 X:48038702-48038724 GAGAGTGAAGGTGATGCTGGAGG + Intronic
1190458172 X:50645189-50645211 CAGAGTGATACTGATGCTCCTGG + Intronic
1191930475 X:66366154-66366176 GACAGAAAGTCTGATGCTGCAGG - Intergenic
1192249798 X:69402370-69402392 CAGGTGAATGCTGATGCTGCTGG - Intergenic
1193970735 X:88048646-88048668 CAAGGTAATGCTGATGCTGCTGG + Intergenic
1195084198 X:101398813-101398835 GAGAGAATTGTTGATGTTGCTGG - Exonic
1197251299 X:124218696-124218718 GAGAGAAATGCAGAGGGTGCAGG + Intronic
1198228016 X:134664260-134664282 GATGCTAATGCTGATGCTGTTGG + Intronic
1198562064 X:137861141-137861163 ACCAGTGATGCTGATGCTGCTGG + Intergenic
1198737286 X:139800595-139800617 CCCAGTAATGCTGCTGCTGCTGG + Intronic
1199240998 X:145547348-145547370 TTGAGTGATGCTGATACTGCAGG + Intergenic
1199264364 X:145813280-145813302 GAGTTTAATGCTGACTCTGCTGG - Intergenic
1201733297 Y:17229435-17229457 GACAGCAAAGCTGAGGCTGCTGG - Intergenic