ID: 1154337334

View in Genome Browser
Species Human (GRCh38)
Location 18:13476142-13476164
Sequence CCCTTCCATAAGGAAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154337334_1154337345 30 Left 1154337334 18:13476142-13476164 CCTGTGGCTTCCTTATGGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 171
Right 1154337345 18:13476195-13476217 TCACGTTCAGGGGTCACATCTGG 0: 1
1: 0
2: 0
3: 10
4: 91
1154337334_1154337340 -1 Left 1154337334 18:13476142-13476164 CCTGTGGCTTCCTTATGGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 171
Right 1154337340 18:13476164-13476186 GGCTCTGCTTTGTGGGTGAGAGG 0: 1
1: 0
2: 5
3: 29
4: 275
1154337334_1154337343 19 Left 1154337334 18:13476142-13476164 CCTGTGGCTTCCTTATGGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 171
Right 1154337343 18:13476184-13476206 AGGTGGCAAAGTCACGTTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 100
1154337334_1154337344 20 Left 1154337334 18:13476142-13476164 CCTGTGGCTTCCTTATGGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 171
Right 1154337344 18:13476185-13476207 GGTGGCAAAGTCACGTTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 88
1154337334_1154337342 18 Left 1154337334 18:13476142-13476164 CCTGTGGCTTCCTTATGGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 171
Right 1154337342 18:13476183-13476205 GAGGTGGCAAAGTCACGTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 84
1154337334_1154337338 -9 Left 1154337334 18:13476142-13476164 CCTGTGGCTTCCTTATGGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 171
Right 1154337338 18:13476156-13476178 ATGGAAGGGGCTCTGCTTTGTGG 0: 1
1: 0
2: 1
3: 32
4: 223
1154337334_1154337339 -8 Left 1154337334 18:13476142-13476164 CCTGTGGCTTCCTTATGGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 171
Right 1154337339 18:13476157-13476179 TGGAAGGGGCTCTGCTTTGTGGG 0: 1
1: 0
2: 5
3: 22
4: 218
1154337334_1154337341 2 Left 1154337334 18:13476142-13476164 CCTGTGGCTTCCTTATGGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 171
Right 1154337341 18:13476167-13476189 TCTGCTTTGTGGGTGAGAGGTGG 0: 1
1: 1
2: 2
3: 30
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154337334 Original CRISPR CCCTTCCATAAGGAAGCCAC AGG (reversed) Intronic
900005034 1:39554-39576 CTCCTTCATAAGCAAGCCACAGG - Intergenic
900927790 1:5717086-5717108 CCCTTCCTCAAGGCAGGCACAGG + Intergenic
901225382 1:7610294-7610316 CCTTTCCCTCAGGGAGCCACCGG - Intronic
903724416 1:25430430-25430452 CCCTTACATAATGACGCGACTGG + Intergenic
907410916 1:54282667-54282689 CCCAGCCCTGAGGAAGCCACAGG + Intronic
907609732 1:55856444-55856466 CCCTGCCAGAAGGAAGACAATGG - Intergenic
915889441 1:159758586-159758608 CTGTTCAATATGGAAGCCACTGG + Intergenic
917776561 1:178342804-178342826 ACCTTGGATAAGGAAGCAACTGG - Intronic
918657393 1:187045480-187045502 TCCTGCCATGAGGAAGCCACAGG - Intergenic
920673733 1:208024484-208024506 TCCTTCCTTAAGGATGCCCCAGG + Exonic
920853290 1:209643724-209643746 CCCTCCCATGAGGAAGCCAGAGG + Intronic
1070654032 10:78258740-78258762 CCATTCCAAAAGGGAGCAACTGG - Intergenic
1071337981 10:84617244-84617266 CCTTTCCAAAAGGAAGACATAGG - Intergenic
1072543138 10:96413575-96413597 CACATCCCTAAGGAAGCCCCTGG - Intronic
1073666534 10:105540406-105540428 CCCTTTCAAATGGAAGCCTCTGG - Intergenic
1077667474 11:4126320-4126342 CCCTGCAATATGGTAGCCACTGG - Intronic
1078596931 11:12695711-12695733 CCCTTCCTTACAAAAGCCACTGG - Intronic
1083932163 11:65852005-65852027 CTCTTCCCTAAGAAAGTCACTGG + Intronic
1084465577 11:69321107-69321129 CACTCCCAAAAGGAAGCCAGAGG - Intronic
1085312109 11:75522868-75522890 CCCTGCCAGCAGGAAGCCAAGGG + Intronic
1088929779 11:114340075-114340097 CCCTTCCATGAGGCTGACACAGG + Intergenic
1089756538 11:120691693-120691715 CCATGCCAGAAGAAAGCCACTGG - Intronic
1091379016 12:43733-43755 CTCCTTCATAAGCAAGCCACAGG - Intergenic
1092779962 12:11977194-11977216 CCCTTCCAGAAGGAATCCTAAGG + Intergenic
1096660659 12:53122180-53122202 CCCCACCTTAAGGAAGCCAGGGG - Intronic
1098026164 12:66204011-66204033 CCCTTCCAGATAAAAGCCACAGG - Intronic
1098187961 12:67918571-67918593 GCCTTCTATATGGAAGTCACTGG - Intergenic
1099113982 12:78600853-78600875 CACTTCCCTAAAGAAGCAACAGG + Intergenic
1099907485 12:88789771-88789793 CCATTCCAAAAGGAAGAAACTGG + Intergenic
1100698242 12:97118772-97118794 CCCTTCTATAAAGCAGCCACAGG + Intergenic
1101616895 12:106346477-106346499 CTCTTCAATGAGGAAGCCATGGG + Exonic
1102230748 12:111260595-111260617 CTGTTCAATAAGGCAGCCACCGG - Intronic
1103949403 12:124542887-124542909 CCCTTCCATTGAGAAGCCGCCGG + Intronic
1103983962 12:124755007-124755029 CCCTTGGATCAGGAAGGCACAGG + Intergenic
1104659078 12:130596233-130596255 CCCATTCATCAGGAAGCCATGGG + Intronic
1104758629 12:131284103-131284125 CCCTTCCCCGAGGCAGCCACTGG - Intergenic
1106165925 13:27246346-27246368 CCCTTCCGTATGGAATCCATTGG - Intergenic
1107623103 13:42253814-42253836 CCGTTCAATATGGTAGCCACTGG + Intronic
1108757188 13:53517963-53517985 CCCTTCCATAAGAGAACCCCTGG + Intergenic
1110511726 13:76358746-76358768 TTCTTCCATAAGGAAAGCACAGG - Intergenic
1112103849 13:96218961-96218983 GCCTTCCATAATGATGCCAATGG + Intronic
1116040399 14:39679549-39679571 CCCTTGCATGAGGACGCCAGAGG - Intergenic
1116757981 14:48972050-48972072 CCCTACAATAAGAAAACCACTGG + Intergenic
1122234604 14:100324579-100324601 CCCTTCCTCAGGGAAGCTACTGG + Intronic
1122483029 14:102060018-102060040 CCCTTCAAAGAGGAAGACACTGG - Intergenic
1122692382 14:103537536-103537558 CCCCTCCCTCAGGAAGCCCCGGG + Intergenic
1122856791 14:104563844-104563866 CCCATGCATGAGGATGCCACTGG + Intronic
1122982557 14:105198221-105198243 CCCCTCCCTCAGCAAGCCACTGG + Intergenic
1125580586 15:40782760-40782782 TCCATCCATGAGGCAGCCACCGG + Intronic
1127363190 15:58262900-58262922 CCCTTCCCTAAGGCAGCACCAGG + Intronic
1128188629 15:65667980-65668002 CCCTTGGATAAGGAAGATACTGG - Exonic
1129240782 15:74250963-74250985 ACCTATCATAAGAAAGCCACAGG + Intronic
1129514193 15:76146923-76146945 CCCTGCCGTGAGGAAGCCCCTGG - Intronic
1132448478 15:101951390-101951412 CTCCTTCATAAGCAAGCCACAGG + Intergenic
1135043446 16:19135689-19135711 CCCTTGCAGGAGGAAGCCAAGGG - Intronic
1137328394 16:47464479-47464501 CCCTTACACCAGGATGCCACAGG - Intronic
1138332342 16:56225108-56225130 CCCTGACACAAGGCAGCCACAGG + Intronic
1139303056 16:65961816-65961838 CCCTTACATAAGGAAGGAAGGGG + Intergenic
1140269633 16:73453620-73453642 CTTTTCCATATGGAATCCACGGG - Intergenic
1141571701 16:84938125-84938147 CCCTCCCATAGAGAGGCCACAGG + Intergenic
1142113680 16:88345413-88345435 CCGTCCCATAAGGAAGCCCTGGG - Intergenic
1144036581 17:11371314-11371336 TCCTTCCCTGAGGAAGCCCCAGG - Intronic
1147512366 17:41081892-41081914 CCATTCCAAAAGGGAGCAACAGG - Intergenic
1147514539 17:41103064-41103086 CCATTCCAAAAGGCAGCAACAGG - Intronic
1149338873 17:55666079-55666101 GCCTTCCAGAAGGAATCCAGGGG + Intergenic
1154337334 18:13476142-13476164 CCCTTCCATAAGGAAGCCACAGG - Intronic
1155793670 18:30006222-30006244 CCCTTCCAGAACTAAGCGACAGG + Intergenic
1158595925 18:58815911-58815933 CCTTTGCATAAGGAACCAACCGG + Intergenic
1159877429 18:73828002-73828024 CACTTCCATAAGGAATCTGCAGG - Intergenic
1160636787 19:81163-81185 CTCCTTCATAAGCAAGCCACAGG - Intergenic
1162973596 19:14195651-14195673 CAGGTCCATAAGGAAGCCGCAGG + Intronic
1164369797 19:27634691-27634713 CTCTCCCATAAGAATGCCACAGG + Intergenic
926769091 2:16351997-16352019 CCATTCCAAAAGGGAGCAACTGG - Intergenic
926819020 2:16832645-16832667 CCCTTCCAAAAGGAAGAAATAGG - Intergenic
928161153 2:28926047-28926069 CCTTTCCATAAGCAAGTCAAAGG - Intronic
928196679 2:29221314-29221336 CCCTCCCATGAGGAATCCACGGG - Intronic
935828278 2:106973294-106973316 CTATTCCCTAAAGAAGCCACAGG - Intergenic
936650577 2:114421929-114421951 CCCTTGCATAGGGAAGGCAATGG + Intergenic
936971120 2:118177205-118177227 CCCTTCCATAAGCTAGCCTTTGG - Intergenic
938736647 2:134191860-134191882 CCCACCCATCAGGAAGCCGCTGG - Intronic
938736656 2:134191913-134191935 CCCTTCCATCAGGAAGCCGCTGG - Intronic
938736669 2:134191969-134191991 CCCTACCATCAGGAACCCGCTGG - Intronic
941584036 2:167334559-167334581 TCCTTCAATAAGGAAGTAACAGG - Intergenic
948031491 2:234821358-234821380 ACCCTCCATAATGCAGCCACTGG + Intergenic
1169990986 20:11502216-11502238 GCCATGCATAAAGAAGCCACAGG + Intergenic
1170578108 20:17680062-17680084 CCCTTCCAGAAAGAAGCTTCCGG - Exonic
1171170141 20:23008471-23008493 CCATTCCACAAGGATGGCACAGG + Intergenic
1171188517 20:23141412-23141434 TGCTTCCATAAGTAAGGCACAGG + Intergenic
1171335895 20:24385086-24385108 ACATTCCATAAGGAAGCCTCTGG - Intergenic
1172101662 20:32487437-32487459 CTCTCCCAGGAGGAAGCCACTGG + Intronic
1174061809 20:47838405-47838427 ACCTTCCATAAAGCAGCTACAGG + Intergenic
1174069699 20:47890824-47890846 ACCTTCCATAAAGCAGCTACAGG - Intergenic
1174524775 20:51162173-51162195 CCCTGTCACCAGGAAGCCACAGG + Intergenic
1179487392 21:41719200-41719222 CCAATCCATCAGGAAGCCATGGG + Intergenic
1181571364 22:23769353-23769375 CCCCTCCATAAGGAAGGAGCAGG + Intronic
1184506362 22:44906238-44906260 CCCGTCCATCAGGAAGACTCTGG - Intronic
1185065305 22:48629075-48629097 CCCTTCCTTCAGGAGGCCGCCGG - Intronic
949996410 3:9620697-9620719 CCCTACGATAAGGAAGCAAATGG - Intergenic
950415039 3:12864304-12864326 TTCTCCCAAAAGGAAGCCACTGG - Intronic
950906121 3:16539888-16539910 CCCATCCATCAGGAAGCGCCTGG - Intergenic
952414896 3:33081550-33081572 CCCTTCAGGAAGGAAGGCACTGG + Intronic
953455150 3:43035016-43035038 TCCTTCCACAAAGCAGCCACGGG - Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
955213206 3:56961499-56961521 CCCTCCCACAAGGAACCCCCAGG - Intronic
957306160 3:78461213-78461235 CTCTTCCATGAGGAAGACAGGGG - Intergenic
964525595 3:157612845-157612867 CCCTTCCACAAGATAGTCACGGG - Intronic
968111873 3:196054991-196055013 CCCTTCCAACAGGAACACACAGG + Intronic
969497461 4:7534331-7534353 CCCCCCCATCAGGGAGCCACAGG + Intronic
970400383 4:15711854-15711876 CTTTTCCAAAAGGAATCCACAGG - Exonic
971504272 4:27348806-27348828 CCCATCCATAAGGAAGGTTCTGG + Intergenic
974070362 4:57118002-57118024 CCCTGCTGTAAGAAAGCCACAGG - Intergenic
975230314 4:71924690-71924712 CCATTCCAAAAGGGAGACACTGG - Intergenic
978128772 4:105168434-105168456 CCCTTCCTTCAGAGAGCCACAGG + Intronic
982045314 4:151439255-151439277 CCCTTCCCCAAGGAAGACTCTGG - Intronic
986695148 5:10348481-10348503 CTCTGCCATTGGGAAGCCACAGG + Intergenic
995707969 5:115004741-115004763 CCATTCCAGAAGGAAGGAACAGG - Intergenic
996282288 5:121745079-121745101 TCCTTCCACAAAGAAGGCACAGG - Intergenic
997049453 5:130362555-130362577 CCATTCCAAAAGGAAGACATAGG + Intergenic
999394401 5:151217901-151217923 CATTTCCTTAAGGAAGGCACAGG + Intronic
999906348 5:156144785-156144807 CCATTCCATAAGGAAGAAATTGG - Intronic
1006758159 6:36435913-36435935 CCCTTGCATCAGGAAGCTAGTGG + Intronic
1006936706 6:37723670-37723692 CCCTGCCCTCAGGAAGCCCCAGG + Intergenic
1007325288 6:41054771-41054793 TCCTTCCATAAGAAAGCCACTGG - Intronic
1008416411 6:51245824-51245846 CCCTTCCATAAAAAAGCCAAGGG - Intergenic
1008636373 6:53415022-53415044 CCCTGCCTTAAGCAAACCACTGG + Intergenic
1010701477 6:79053530-79053552 CAGCTCCATAAGGAAGCCTCGGG - Intronic
1010803074 6:80200245-80200267 CCAAGCCAAAAGGAAGCCACTGG - Intronic
1012073376 6:94652731-94652753 CCTATCCATAAAAAAGCCACAGG - Intergenic
1016422853 6:143902797-143902819 CCCTTCCATAATTAAGCCCTTGG - Intronic
1018039218 6:159906942-159906964 CCCATCCATGAGGAGGCCTCAGG - Exonic
1018376747 6:163219921-163219943 CCTTTCCATAGGGCAGCCAGGGG - Intronic
1018592570 6:165443248-165443270 CCATTCCAAAAGGAAGAAACTGG + Intronic
1023853253 7:44162574-44162596 CCCTGGCATGTGGAAGCCACAGG - Intronic
1024798802 7:53051617-53051639 CCCTTCCATGAGGAAAACATGGG + Intergenic
1025907659 7:65800331-65800353 CCCTACCTCCAGGAAGCCACAGG - Intergenic
1030941618 7:115657979-115658001 CTCTTCCATAAGGAACACTCAGG - Intergenic
1031191602 7:118559212-118559234 TTCTTCCATTAGGAAGCCATTGG - Intergenic
1031360593 7:120844516-120844538 CCATTCCAAAAGGAAGAAACTGG + Intronic
1032795396 7:135272132-135272154 GTCTTCCATAATGAAGTCACAGG + Intergenic
1033727284 7:144132383-144132405 CTCTTCCATGAGGAAGGCAAAGG + Intergenic
1035183068 7:157104933-157104955 CACCTCCAAAGGGAAGCCACAGG - Intergenic
1035328693 7:158082658-158082680 TCCTGGCATAAGGAAGCCAAAGG - Intronic
1035739808 8:1918245-1918267 CCCATTCATGAGGAAGCCTCAGG + Intronic
1037917853 8:22783485-22783507 CACCGCCATAAGAAAGCCACTGG - Intronic
1038759431 8:30373130-30373152 CCATTCCAAAAGGAAGAAACTGG + Intergenic
1038981199 8:32761451-32761473 CCCTTGCAAAAGTAAGCAACAGG - Intronic
1042708254 8:71685526-71685548 CCCAGCTAGAAGGAAGCCACTGG + Intergenic
1047176278 8:122543679-122543701 CAATTCCCTAAGGAATCCACAGG - Intergenic
1048246127 8:132802526-132802548 CCCGTCCATAAGGAATTCACAGG - Intronic
1048290105 8:133174765-133174787 CCCTTCCCTAAGGTAGCCCTAGG + Intergenic
1049126339 8:140792400-140792422 CCCTTCCCAATGGAGGCCACAGG - Intronic
1049887728 9:39336-39358 CTCCTTCATAAGCAAGCCACAGG - Intergenic
1051361948 9:16288888-16288910 CACCTCCACAAGGAAGCAACAGG + Intergenic
1053255385 9:36612889-36612911 TCTTTCCATAAAGAAGGCACAGG - Intronic
1054724122 9:68633529-68633551 CCATCCCATATGGTAGCCACTGG - Intergenic
1055194104 9:73565731-73565753 GCCTTCCCTCAAGAAGCCACAGG + Intergenic
1057228427 9:93304577-93304599 CCTGTCCATAAGGCAGCAACGGG - Intronic
1058746118 9:107992204-107992226 CATTTCCTTAAGGAAGTCACAGG + Intergenic
1061237102 9:129349579-129349601 CCCTCCCCTGAAGAAGCCACAGG - Intergenic
1061424183 9:130488931-130488953 CCCTTCCACCAGGGAGCCAGGGG - Intronic
1061731404 9:132617192-132617214 CCCTTCCTTTAGAGAGCCACGGG + Intronic
1186584957 X:10863133-10863155 TTTTTCTATAAGGAAGCCACGGG + Intergenic
1190451986 X:50591418-50591440 AACTTACACAAGGAAGCCACTGG + Intergenic
1192923113 X:75728878-75728900 CCATTCCATAAGGAAGAAATAGG + Intergenic
1193957096 X:87876804-87876826 CCCTTCCACAAGGACACCTCTGG + Intergenic
1198050004 X:132942479-132942501 CCCTTCCAAAAGGAAGAGAATGG + Intronic
1198664735 X:139008121-139008143 CCCTTCCCAAAGGCAGCCACAGG + Intronic
1201994904 Y:20075374-20075396 ACCTTCCAGAAGGAAGAAACTGG + Intergenic
1201994964 Y:20076119-20076141 ACCTTCCAGAAGGAAGAAACTGG + Intergenic
1201995643 Y:20085261-20085283 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1201995865 Y:20088126-20088148 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1201998473 Y:20122504-20122526 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1201999106 Y:20130993-20131015 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1202001540 Y:20163711-20163733 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1202001763 Y:20166576-20166598 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1202003050 Y:20184110-20184132 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1202005180 Y:20261855-20261877 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1202005273 Y:20263099-20263121 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1202005499 Y:20266086-20266108 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1202005686 Y:20268576-20268598 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1202006756 Y:20282783-20282805 ACCTTCCAGAAGGAAGAAACTGG - Intergenic
1202008127 Y:20301137-20301159 ACCTTCCAGAAGGAAGAAACTGG - Intergenic