ID: 1154337667

View in Genome Browser
Species Human (GRCh38)
Location 18:13478384-13478406
Sequence AACCCAGTTGATGTTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154337667 Original CRISPR AACCCAGTTGATGTTCAGAA TGG (reversed) Intronic
904830007 1:33300204-33300226 AACACAGTTAATATTCAAAACGG - Exonic
904868516 1:33601583-33601605 AACCCCGATGATTCTCAGAATGG + Intronic
906249340 1:44299508-44299530 AAACTAGCTGATGTTCAAAAAGG + Intronic
911205179 1:95085494-95085516 ACCTCAGTTGATGTTCTGAAAGG + Intergenic
914003138 1:143709596-143709618 AACCCAGCTGATGTTTCTAAAGG + Intergenic
914094346 1:144532082-144532104 AACCCAGCTGATGTTTCTAAAGG + Intergenic
914304175 1:146401806-146401828 AACCCAGCTGATGTTTCTAAAGG - Intergenic
917146953 1:171902386-171902408 AGCCCTGTTGATATTCAGGAAGG + Intronic
918249462 1:182688793-182688815 AACCCAGCTGAAGTTCATCAAGG + Intergenic
921780831 1:219161360-219161382 AACCCCTTTGAGGTTCAAAAAGG - Intergenic
1062805495 10:416647-416669 AAACCAGTTGATTTTCAGAATGG - Intronic
1064478349 10:15715750-15715772 CACGAAGTGGATGTTCAGAATGG + Intronic
1064997029 10:21305172-21305194 AACCCATTTTATCCTCAGAACGG - Intergenic
1067928572 10:50536875-50536897 AACCCAGATGATGTCCAAAAGGG - Intronic
1068385567 10:56322586-56322608 ATCACAGGTGATGTTCAGACTGG - Intergenic
1068876806 10:62005777-62005799 AAAACATGTGATGTTCAGAAAGG - Intronic
1070764302 10:79047738-79047760 AAGCCATTTGATGCTCAGAGAGG + Intergenic
1071263233 10:83940120-83940142 ATTCCACTTGCTGTTCAGAAAGG - Intergenic
1073218437 10:101849952-101849974 AACCCAGTAGATCAGCAGAATGG - Intronic
1073803447 10:107069061-107069083 AACTCAGTTTATAGTCAGAAAGG - Intronic
1076698881 10:132260091-132260113 AACCCTGATGATGTTGAGAGAGG + Intronic
1078149537 11:8746936-8746958 AACCCATTTGATTTACAGATTGG - Intronic
1079704177 11:23592681-23592703 AACCCAGTAGATGCTCAGTTGGG - Intergenic
1081078308 11:38704797-38704819 AACCTAGGTGATCTTCAGCATGG + Intergenic
1081284942 11:41256437-41256459 ATGCCAGTTGATGTTTGGAATGG - Intronic
1083004757 11:59332998-59333020 AACTGAGATGATCTTCAGAATGG + Intergenic
1084168192 11:67386926-67386948 AACCCACTTCAGGTGCAGAAAGG - Intronic
1084244479 11:67847148-67847170 GACCCGGTTTATCTTCAGAAGGG - Intergenic
1084828204 11:71747413-71747435 GACCCGGTTTATCTTCAGAAGGG + Intergenic
1088385845 11:109254861-109254883 AAGACAGTTGATATTAAGAAAGG - Intergenic
1088417260 11:109603124-109603146 AAACTCGTTAATGTTCAGAATGG - Intergenic
1089976439 11:122736072-122736094 AAGACAGTGGAGGTTCAGAAAGG + Intronic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1095282072 12:40364275-40364297 CTCACAGTTTATGTTCAGAAGGG + Intronic
1099613185 12:84902427-84902449 AACCAAGTTGTTTTTCAGAGTGG - Intronic
1103417958 12:120757211-120757233 GACCCAGCTGCTGTCCAGAAGGG - Intergenic
1109307049 13:60652391-60652413 TAACCAGTTGATGTTAAGTAAGG + Intergenic
1109723468 13:66307540-66307562 AACTCCATTGATGTTTAGAAAGG - Intronic
1113140061 13:107137818-107137840 TTCCCAGTTGACGTTCAGTAGGG - Intergenic
1114804597 14:25820342-25820364 ATTCCACTTGATTTTCAGAAAGG + Intergenic
1120552895 14:85892978-85893000 AAACCAGCTGAGGTTCAGAGAGG + Intergenic
1120913412 14:89688521-89688543 AACCCAGTTGATCTTTCTAATGG - Intergenic
1125293032 15:38170822-38170844 AACCCAAATGATTTTCAGACGGG + Intergenic
1128778432 15:70341737-70341759 AGCCCAGCTGATATTCACAAGGG + Intergenic
1129272327 15:74425677-74425699 AACCCAGCTTATATTCAAAACGG - Intronic
1130300800 15:82678873-82678895 AACATAGTGGATGTTCACAAGGG + Intronic
1131926558 15:97390823-97390845 AAACCAGATGTAGTTCAGAAAGG - Intergenic
1132066399 15:98734653-98734675 AGGGCAGTTAATGTTCAGAATGG - Intronic
1133692219 16:8227573-8227595 AACACAGTTTATGGTCAAAACGG - Intergenic
1139312435 16:66039106-66039128 AGCCCATTTGAAGTTCAGGAAGG - Intergenic
1140773958 16:78232705-78232727 ATCCCATTTGATCTTCAAAAGGG - Intronic
1142245095 16:88966718-88966740 CACCCAGCTCGTGTTCAGAAAGG - Intronic
1142794850 17:2299784-2299806 GACCCAGGAGAAGTTCAGAAAGG - Exonic
1143741954 17:8960950-8960972 TAGCCACTTGATGTTCAGCATGG - Intronic
1144561856 17:16327269-16327291 AGCAGAGTTGCTGTTCAGAAAGG - Intronic
1145864578 17:28232496-28232518 GACCCGGTTCATCTTCAGAAGGG - Intergenic
1153113067 18:1617483-1617505 AACCCATTTGATTTTGAAAAGGG + Intergenic
1154337667 18:13478384-13478406 AACCCAGTTGATGTTCAGAATGG - Intronic
1155235470 18:23814485-23814507 ACCCCAGTGGATGTTCAGGTAGG + Exonic
1155665407 18:28301998-28302020 AGCCAAGTTGCTGTTCAGGAGGG + Intergenic
1156500891 18:37557406-37557428 AACACAGTGGCTGTGCAGAAAGG + Intronic
1156535457 18:37860417-37860439 AAAACAGCTGAGGTTCAGAATGG + Intergenic
1157610874 18:48954363-48954385 TACACAGTAAATGTTCAGAATGG - Intergenic
1161664059 19:5564378-5564400 AACCCATTTGATGCCCAGAGAGG + Intergenic
1163426432 19:17243378-17243400 AATCCATTTGAAGCTCAGAATGG + Intronic
1163966109 19:20748814-20748836 GACCCGGTTTATCTTCAGAAGGG - Intronic
1166400101 19:42472175-42472197 AACCCAGTTGGTGTCTTGAATGG - Intergenic
926300673 2:11599873-11599895 AACCCAGATGAATTTCAGATGGG + Intronic
926510207 2:13766895-13766917 AACTCAGTTGAGATTCATAATGG + Intergenic
927187449 2:20492022-20492044 AAGCCATGTGATGTGCAGAAGGG + Intergenic
927500723 2:23581295-23581317 AATCCATGTGATGTTCAAAACGG - Intronic
928756449 2:34531464-34531486 AACCCAGGTTATCTTCTGAAGGG - Intergenic
929136855 2:38632945-38632967 AACCCAATTGAGGCTGAGAATGG - Intergenic
933803249 2:85979800-85979822 AACCCAGTGGTTGTTTAGGAAGG - Intergenic
935992355 2:108731618-108731640 AAGACAGTAGATGCTCAGAAAGG - Intronic
936127673 2:109804275-109804297 AAGACAGTAGATGCTCAGAAAGG - Intronic
936217024 2:110567210-110567232 AAGACAGTAGATGCTCAGAAAGG + Intronic
936426163 2:112421794-112421816 AAGACAGTAGATGCTCAGAAAGG + Intronic
938143440 2:128813929-128813951 CACTTAGTGGATGTTCAGAAGGG - Intergenic
942919713 2:181357265-181357287 GTCACAGTTAATGTTCAGAAAGG + Intergenic
1172798978 20:37563346-37563368 AACCCTGTTGAGGTTGACAAAGG + Intergenic
1174668840 20:52286482-52286504 AACCTAATTGATGTGGAGAAGGG - Intergenic
1175064473 20:56273322-56273344 AACCCAGTTTTTCTTCACAAGGG + Intergenic
1181989583 22:26827280-26827302 ATCTCATTTGATTTTCAGAACGG - Intergenic
951097088 3:18644731-18644753 GACCCAGTTGAGGTTTAGAGAGG - Intergenic
951757096 3:26102962-26102984 ACCCCAGAGGATCTTCAGAAAGG + Intergenic
953841601 3:46394247-46394269 AGCCCTGTTGATGTTCTGGATGG - Intergenic
955411492 3:58658329-58658351 AAGAAAGTTGAAGTTCAGAAAGG + Intronic
959421443 3:106134795-106134817 TACCTAGTTATTGTTCAGAAAGG + Intergenic
961792805 3:129388741-129388763 AACCTAGTGGATGTTCAGCACGG + Intergenic
961892595 3:130142902-130142924 GACCCGGTTTATCTTCAGAAGGG - Intergenic
964387163 3:156160290-156160312 AAACAAGTCAATGTTCAGAAAGG - Intronic
966551859 3:181214210-181214232 AGCCCAGTAGAGGTTCAGGAAGG - Intergenic
967517199 3:190384143-190384165 AAATCAGTTGCTGTTCTGAAAGG - Intronic
969750170 4:9104241-9104263 GACCCGGTTTATCTTCAGAAGGG + Intergenic
970415231 4:15850475-15850497 AAGGAAGTTGAAGTTCAGAAAGG - Exonic
970887553 4:21004023-21004045 AAGGCATTTGATGTTCATAAGGG + Intronic
971824652 4:31605264-31605286 AACCCAGTTGGGGTTCCTAAAGG - Intergenic
971925029 4:32997523-32997545 AACCCAGCTGATCTTTAGCAGGG - Intergenic
972272514 4:37524813-37524835 AACTGAGGTGATGTTGAGAAAGG + Intronic
972658261 4:41087963-41087985 AACCAAGTCGGTGTTAAGAATGG + Intronic
989298147 5:39854220-39854242 AAACCTGATGATGTTCAAAATGG + Intergenic
989994673 5:50814605-50814627 AACATAAATGATGTTCAGAATGG + Intronic
990452794 5:55951982-55952004 CTTCCTGTTGATGTTCAGAATGG - Exonic
991240183 5:64449613-64449635 AACCTATTAGATGTTCAGATTGG - Intergenic
995073653 5:107954977-107954999 CACCCCGTAGATGTTAAGAATGG + Intronic
997504825 5:134408869-134408891 ACCCCACTTGATTTTCAGGATGG - Intronic
998884784 5:146683009-146683031 AACCCATCTGATCTTCAGGATGG + Intronic
999745321 5:154587511-154587533 AACCTGGGGGATGTTCAGAAAGG - Intergenic
1005130712 6:22504454-22504476 AAAACAGTATATGTTCAGAAAGG - Intergenic
1006990458 6:38210927-38210949 GACCCACTTGGTGTTCAGGAGGG - Intronic
1008646032 6:53516004-53516026 AACTCAGTTAATGCTCAAAAAGG + Intronic
1009619723 6:66059188-66059210 AAGCCATTTGCTTTTCAGAATGG + Intergenic
1014011736 6:116483974-116483996 CACCCAGCAGGTGTTCAGAAAGG + Intergenic
1015240111 6:131012460-131012482 AGCCCAGGTGATGTTCCGTAGGG - Intronic
1018465151 6:164037437-164037459 AAGCCAGTTCATGGTCAGAAGGG - Intergenic
1020079409 7:5279258-5279280 AAGCCAGTTTATGTTCCAAAAGG + Intronic
1020322809 7:6952405-6952427 GACCCGGTTTATCTTCAGAAGGG - Intergenic
1021732671 7:23611511-23611533 AACACAGTGGATGTCGAGAACGG + Exonic
1022032254 7:26503215-26503237 GACCCAGGTGATCTTCAGACTGG + Intergenic
1022831184 7:34068340-34068362 TAACCAGTTGAAGTTAAGAAGGG + Intronic
1022852332 7:34277080-34277102 AACCCAATTGATGCTCCCAATGG - Intergenic
1023859400 7:44208462-44208484 AACCCAGTAAATGGTCAGACAGG - Intronic
1024013109 7:45287528-45287550 CACCCAGTTGGTGTCCAGAGAGG - Intergenic
1024525147 7:50342177-50342199 AACCCAATTGATGTTAAAATTGG - Intronic
1024977165 7:55124659-55124681 CACCCAATGGATGATCAGAAGGG - Intronic
1025156720 7:56613706-56613728 AAGCCAGGACATGTTCAGAATGG - Intergenic
1025199487 7:56952941-56952963 AAGCCAGTTTATGTTCCAAAAGG - Intergenic
1025672459 7:63623989-63624011 AAGCCAGTTTATGTTCCAAAAGG + Intergenic
1026395498 7:69949176-69949198 AACCCAAGTGATGAACAGAATGG + Intronic
1027383853 7:77640916-77640938 AACCAAGGGGATGTTGAGAACGG + Intergenic
1033812146 7:145028061-145028083 GACACAGTTGATGTTCACCAGGG + Intergenic
1034701762 7:153102601-153102623 AAATCAGTTCATCTTCAGAAAGG + Intergenic
1035384923 7:158464967-158464989 AAGGGAGTTGAAGTTCAGAAAGG + Intronic
1036709184 8:11067413-11067435 AACCCTTTTGATGTTCAAATGGG - Intronic
1037648013 8:20811308-20811330 AGCCCATTTGATGTTGAGCAAGG + Intergenic
1038890712 8:31719650-31719672 ACCCCAGTTGACCTTCAAAATGG - Intronic
1040345877 8:46492998-46493020 AACCTAATGAATGTTCAGAAAGG + Intergenic
1045428816 8:102094144-102094166 AACTTAGATGATGTTCAGACTGG + Intronic
1045730113 8:105228219-105228241 AACCCAGTTGATGTCCAAGTGGG + Intronic
1046349667 8:112990873-112990895 AACACATTTGGTTTTCAGAAGGG - Intronic
1047104101 8:121714184-121714206 AAGCCAGTTGATGCCCTGAATGG - Intergenic
1047672149 8:127159794-127159816 AGCCCAGTTGAGGTCCAGAGAGG + Intergenic
1048015415 8:130492180-130492202 AACCGAGGTAATGTGCAGAAAGG - Intergenic
1048732840 8:137462868-137462890 TTCCCAGGTGATGTCCAGAATGG - Intergenic
1049882002 8:145071330-145071352 GACCCTGTTCATCTTCAGAAGGG - Intergenic
1055307268 9:74942831-74942853 AAACCAGTTGACCTTCAGATAGG - Intergenic
1058795248 9:108491499-108491521 AAACAAATTGCTGTTCAGAAGGG - Intergenic
1060449588 9:123724143-123724165 AACCCAGTTGACTCTAAGAATGG - Intronic
1193052528 X:77116204-77116226 AACTCAGTTGATGTTCATGGAGG - Intergenic
1193984651 X:88225741-88225763 AATCCAGTTGATATTCAGAGTGG + Intergenic
1194400824 X:93436476-93436498 GACCCAGTTTATCTTCAGAAGGG + Intergenic
1194740849 X:97572726-97572748 AAAATAGTTAATGTTCAGAAGGG - Intronic
1197695379 X:129544150-129544172 ATGCTAGTTGACGTTCAGAATGG + Intronic
1200948539 Y:8869426-8869448 GACCCAGTTCATCTTCAGAAGGG + Intergenic
1202151396 Y:21847065-21847087 ACCCCAGTTGGGATTCAGAAAGG - Intergenic