ID: 1154337913

View in Genome Browser
Species Human (GRCh38)
Location 18:13480877-13480899
Sequence GCCAGGACGTGGGTTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154337913 Original CRISPR GCCAGGACGTGGGTTTTCAC TGG (reversed) Intronic
900437320 1:2637357-2637379 GCTCGGAGGTGGGGTTTCACTGG + Intronic
901006048 1:6171975-6171997 CCCAGGAGGTGGGTGATCACAGG - Intronic
901187332 1:7383425-7383447 GACAGGACCAGGGTTTTAACCGG - Intronic
906697609 1:47834029-47834051 GCCAGGCTGCTGGTTTTCACTGG - Intronic
907615897 1:55926596-55926618 GCTTGGAGGTGGGTTTTCACTGG - Intergenic
1069452381 10:68527713-68527735 GCCAGGTTGTGGGTTTTAATGGG - Intergenic
1070420634 10:76233103-76233125 GCTTGGAGGTGGGATTTCACCGG + Intronic
1071560326 10:86641686-86641708 ACCAGGACATTGGTTTTCTCAGG - Intergenic
1072206364 10:93208475-93208497 GCCAGGGTCTTGGTTTTCACTGG + Intergenic
1072421279 10:95291925-95291947 GTAAGGATCTGGGTTTTCACTGG - Intergenic
1073640020 10:105242031-105242053 GCTTGGAGGTGGGGTTTCACTGG + Intronic
1074745586 10:116528887-116528909 GCTTGGAGGTGGGATTTCACCGG - Intergenic
1074990733 10:118704463-118704485 GCCTGGAGGTGGGCTTTCACTGG - Intronic
1076268737 10:129132164-129132186 GCAAGGACGTGGATTTTCCATGG - Intergenic
1078953861 11:16167449-16167471 GCCCTGACTTGGGTTTTGACAGG - Intronic
1080853794 11:36094104-36094126 GCTTGGAGGTGGGGTTTCACCGG + Intronic
1081676719 11:44974301-44974323 GCCAGGGCCTGGTTTTTCACAGG + Intergenic
1082663778 11:55948984-55949006 GCTTGGAGGTGGGGTTTCACAGG - Intergenic
1086458845 11:86985679-86985701 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1089159056 11:116423908-116423930 CCCAGGAGGTGGGTCCTCACGGG + Intergenic
1090954480 11:131502302-131502324 ACCAGGACGTGGGATCTCACTGG + Intronic
1091967715 12:4759373-4759395 GCCACTATTTGGGTTTTCACTGG - Intronic
1092698591 12:11201830-11201852 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1093502443 12:19828056-19828078 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1093592382 12:20918021-20918043 GCTTGGAGGTGGGGTTTCACCGG + Intergenic
1096481726 12:51946282-51946304 GCTCGGACTTTGGTTTTCACAGG - Intergenic
1096919938 12:55072770-55072792 GCATGAAGGTGGGTTTTCACCGG + Intergenic
1097666738 12:62485999-62486021 GCCAGCATGTGGGTTTTAATGGG + Intronic
1099606368 12:84806771-84806793 GCCAGGGTGTAGGTTTTTACTGG + Intergenic
1102084529 12:110124803-110124825 ACCAGGACGTGCGTGTTCTCTGG - Exonic
1102691859 12:114767406-114767428 GCCAGGACGTGGAATTACAGGGG + Intergenic
1103418403 12:120760260-120760282 GACAGGAAGTGGGTGTCCACAGG - Intergenic
1104951948 12:132445150-132445172 GCCAGGAAGTGGTTTTGCAGAGG - Intergenic
1106708911 13:32311047-32311069 GCCAGACTGTTGGTTTTCACAGG + Intronic
1107170962 13:37341610-37341632 GCCTGAAGGTGGGGTTTCACTGG - Intergenic
1110735987 13:78937106-78937128 GCCAGGGTGTGAGTTTTCAGAGG + Intergenic
1111202850 13:84962118-84962140 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1111347288 13:86974881-86974903 GCCTGAATGTGGGCTTTCACTGG - Intergenic
1112840607 13:103573074-103573096 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1114906220 14:27130372-27130394 ACCAGCAAGTTGGTTTTCACAGG + Intergenic
1116114046 14:40625406-40625428 GCTTGGAAGTGGGGTTTCACAGG + Intergenic
1116380534 14:44262137-44262159 GCTTGGAGGTGGGGTTTCACCGG + Intergenic
1118240094 14:64047512-64047534 GCATGGAGGTGGGGTTTCACTGG + Intronic
1118648030 14:67858736-67858758 GCTTGGAGGTGGGGTTTCACCGG + Intronic
1118974313 14:70664173-70664195 GCCAGGACCTGGGGTTGCAGTGG - Intronic
1119271852 14:73312757-73312779 GCCAGGAAGTGGGTCTTCTAGGG - Intronic
1124436263 15:29651920-29651942 GCCAGAAGGTGGGGCTTCACTGG - Intergenic
1130031630 15:80319564-80319586 GCCAGGAGGTCTGATTTCACGGG - Intergenic
1130060674 15:80567592-80567614 GCCAGGGGGCTGGTTTTCACAGG - Intronic
1130076286 15:80693776-80693798 GCTAGGACCTGGGTTTTAAAAGG - Intronic
1135926760 16:26701705-26701727 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1137588609 16:49679747-49679769 GCTAGAACGTGGGGCTTCACTGG - Intronic
1137768548 16:50996437-50996459 CCCAGGAGCTGGGTTTTCGCAGG - Intergenic
1138152384 16:54670579-54670601 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1140056824 16:71532591-71532613 GCCAGCTCGTGGGTTTTCCTTGG - Intronic
1140816129 16:78622609-78622631 ACCAGGAGGTGGGGTATCACTGG - Intronic
1143888390 17:10083989-10084011 GCCTGGAGGTGAGGTTTCACAGG + Intronic
1145235077 17:21202492-21202514 TCCAGGACCGGGGTTTCCACTGG - Intronic
1146549523 17:33768611-33768633 GCCTGAAGGTGGGGTTTCACTGG - Intronic
1148415186 17:47500838-47500860 TCCAGGAATTGGGTTTACACAGG - Intergenic
1150726848 17:67658188-67658210 GCTTGGAAGTGGGGTTTCACTGG - Intronic
1152312039 17:79557411-79557433 GACTGGACTTGGGTTTTCTCGGG - Intergenic
1154337913 18:13480877-13480899 GCCAGGACGTGGGTTTTCACTGG - Intronic
1155310505 18:24518417-24518439 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1156042870 18:32843259-32843281 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1156762877 18:40614539-40614561 ACCAGGATGTGTCTTTTCACTGG + Intergenic
1158444213 18:57504795-57504817 GCCAGGATGGGGGCTTTCATGGG - Intergenic
1159076315 18:63685433-63685455 GCTTGGAGGTGGGGTTTCACCGG + Intronic
1159766909 18:72502536-72502558 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1162391006 19:10390239-10390261 GCCCTGACCTGGGTGTTCACAGG + Intergenic
1163153730 19:15429088-15429110 CCCAGGAGGTGGGGCTTCACCGG + Intronic
1164022255 19:21318321-21318343 ACAAAGAGGTGGGTTTTCACAGG - Intronic
1166417253 19:42604887-42604909 GCCAGGAAGTGGGTGTCCTCAGG + Intronic
1167526233 19:49985585-49985607 GCCAGGTCCTGGGTGTCCACTGG - Intronic
926234876 2:11033097-11033119 GCTAGGCTGTTGGTTTTCACTGG - Intergenic
926331296 2:11828202-11828224 GCCAGCACGTGGGAATCCACAGG - Intergenic
932360712 2:71103471-71103493 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
936064820 2:109322902-109322924 GCCAAGAGGTGGCTTTTCCCTGG + Intronic
936250234 2:110862741-110862763 GCCAGGAGGAGGGTCCTCACTGG - Intronic
936739832 2:115491582-115491604 GCCAGGAGGAGGGTTGTCTCGGG + Intronic
937159251 2:119744741-119744763 GCCAGGATCTGGGTTTGCAGAGG - Intergenic
937344102 2:121112744-121112766 GCCAGGGGGTGTGTTCTCACTGG - Intergenic
939463840 2:142531916-142531938 GCTTGGAGGTGGGGTTTCACCGG - Intergenic
940683631 2:156818753-156818775 GCTTGGAAGTGGGGTTTCACTGG + Intergenic
943179457 2:184524688-184524710 GCCTAGAGGTGGGGTTTCACTGG + Intergenic
943190987 2:184679897-184679919 GCCTAGAGGTGGGGTTTCACTGG - Intronic
1170892023 20:20384136-20384158 GCCAGGAAGGAGGTCTTCACTGG - Intergenic
1171536738 20:25899062-25899084 GCCTGCAGGTGGGGTTTCACTGG - Intergenic
1171572663 20:26268716-26268738 GCCAGCAGGAGGGATTTCACAGG + Intergenic
1172724345 20:37026039-37026061 GCCAGGACCTGGGTTCTTAATGG + Intronic
1174283387 20:49455226-49455248 GACCTGACGTGGGTTCTCACAGG + Intronic
1175065092 20:56277462-56277484 GCCTGAAGGTGGGTCTTCACTGG - Intergenic
1177385080 21:20397675-20397697 GCTTGGAGGTGGGATTTCACTGG + Intergenic
1178103482 21:29295243-29295265 GCTTGGAGGTGGGGTTTCACCGG - Intronic
1179626250 21:42651129-42651151 GGTCTGACGTGGGTTTTCACAGG - Intergenic
1182007190 22:26970623-26970645 GCCAGGGAATGGGTTGTCACTGG - Intergenic
1183518632 22:38283214-38283236 GCCAGGTCCTGGGTTTTCTCAGG + Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
953891010 3:46751499-46751521 GCCAGGCCTTGGGCTTCCACAGG + Intronic
954364975 3:50140814-50140836 ACCAGCACGTGGGTTGTCAGGGG - Intergenic
956716272 3:72082957-72082979 GCCAGGAAGAGGGCCTTCACCGG - Intergenic
958169989 3:89927507-89927529 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
959525707 3:107373914-107373936 TCCAGGAGGTTGGCTTTCACAGG - Intergenic
959693582 3:109225085-109225107 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
959897073 3:111617259-111617281 GCCTGAAGGTGGGGTTTCACTGG - Intronic
962936955 3:140090140-140090162 GGCAGGAGGTGGGTTGTCTCGGG + Intronic
965270547 3:166612673-166612695 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
965367760 3:167820777-167820799 GCCTGAAGGTGGGGTTTCACTGG - Intronic
967814503 3:193787670-193787692 GTCATGACGTGGGTCTTCAAGGG + Intergenic
968547877 4:1207902-1207924 GCCAGGGCGTGGGTGTTCCCCGG - Intronic
969169280 4:5346982-5347004 GATAGTACGTGGGTTCTCACAGG - Intronic
969480177 4:7442738-7442760 CCCAGCACGTGGGCTTTCGCAGG + Intronic
969511739 4:7622044-7622066 GGCAGGACGTGGGTATTTCCAGG - Intronic
971124791 4:23741705-23741727 GTCAGGAAGTGTCTTTTCACAGG + Intergenic
971629327 4:28969384-28969406 GCCAAGAGGTGGGTCCTCACCGG + Intergenic
972997015 4:44893012-44893034 GCCAAGAAGAGGGCTTTCACCGG + Intergenic
973970776 4:56211915-56211937 GCCTGGAGGTGGGGTTTCACTGG + Intronic
974210102 4:58761522-58761544 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
974421632 4:61683759-61683781 GCTTGGAGGTGGGGTTTCACTGG + Intronic
974615191 4:64271465-64271487 GCCAGAAGGTGGGGTTTCACGGG - Intergenic
974630511 4:64481525-64481547 GCCAGGAAGTTGGTTCTCCCTGG - Intergenic
976080432 4:81348763-81348785 GCCAGCACATGTGTTATCACTGG - Intergenic
978061445 4:104344914-104344936 GCCTGAAGGTGGGGTTTCACTGG - Intergenic
978267914 4:106849469-106849491 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
979765511 4:124460913-124460935 GAAAGGACGTGGGTTTTGAGAGG + Intergenic
980793110 4:137645441-137645463 ACCAGGACGTGGGTCCTCAAAGG - Intergenic
981570825 4:146148788-146148810 CCCAGGAGATGGGTTTTCCCAGG + Intergenic
982004046 4:151047864-151047886 GCCATGCAGTGGCTTTTCACAGG + Intergenic
983125885 4:163950107-163950129 GCCTGAAGGTGGGGTTTCACTGG + Intronic
985085199 4:186306046-186306068 GCCAGGATGTGGGATGTTACTGG + Intergenic
985189206 4:187353476-187353498 GGCAGGAAGGGGGCTTTCACAGG - Intergenic
987659344 5:20852646-20852668 GCCAGGAAGAGAGTCTTCACAGG - Intergenic
988842434 5:35096123-35096145 GCCAGGAGATGGTTCTTCACAGG - Intronic
991190608 5:63868665-63868687 GCCAGGAGGTGGGTTCTAATAGG + Intergenic
992892326 5:81214752-81214774 GCCTGGATGTGGGTATTCCCAGG + Intronic
993292764 5:86096134-86096156 GCTTGGAGGTGGGGTTTCACCGG + Intergenic
993378272 5:87175921-87175943 GCTTGGAGGTTGGTTTTCACTGG - Intergenic
993409705 5:87558660-87558682 GCGTGGAGGTGGGGTTTCACTGG - Intergenic
994087734 5:95778866-95778888 GCCAGGAGGTGAGTGTTGACTGG + Intronic
994719633 5:103365997-103366019 ACCAGGAAGTGGGCTGTCACCGG - Intergenic
996250093 5:121318778-121318800 GCTTGGAGGTGGGTTTTCAAAGG - Intergenic
997439325 5:133898259-133898281 GTCAGGACATGGCTTCTCACGGG + Intergenic
998480556 5:142459329-142459351 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1000014471 5:157265697-157265719 GCCAGGACTTGGGTGTGCACTGG - Intergenic
1000600873 5:163273289-163273311 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1001761284 5:174210258-174210280 GCCAGGACTCTGGGTTTCACAGG + Intronic
1004065394 6:12239053-12239075 GCCAGGAACTGGGTATTCACAGG - Intergenic
1004983309 6:21050816-21050838 GCTTGGAGGTGGGGTTTCACTGG + Intronic
1005026342 6:21466265-21466287 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1005401576 6:25439533-25439555 CCCAGGCCCTGGTTTTTCACTGG - Intronic
1008330665 6:50240775-50240797 GCCTGAAGGTGGGATTTCACTGG + Intergenic
1010490149 6:76466225-76466247 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1012447595 6:99322539-99322561 TGCAGAAGGTGGGTTTTCACTGG - Intronic
1014684883 6:124484709-124484731 TCCAGGACATGGTTTTTCATAGG + Intronic
1015681497 6:135813574-135813596 GCTTGGACGTGGGATTTCGCTGG + Intergenic
1019076254 6:169390336-169390358 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1022817428 7:33927204-33927226 AACAGCACGTGGGCTTTCACGGG + Intronic
1025288211 7:57685769-57685791 GCCTGCAGGTGGGGTTTCACTGG - Intergenic
1027998992 7:85467050-85467072 GCCAGGACATGGATTTTTATTGG + Intergenic
1033551898 7:142455140-142455162 GCCAGGACGGGGGTTTTACCAGG - Intergenic
1034985609 7:155512209-155512231 GCCAGTGCGTGGGTTTTCTCTGG - Intronic
1037562427 8:20087031-20087053 GCCAGGACGTGGGTATCCTGAGG + Intergenic
1041965479 8:63670194-63670216 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1044132979 8:88549349-88549371 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1046406195 8:113775820-113775842 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1048142922 8:131812507-131812529 GCCAGCCTGTGGATTTTCACTGG + Intergenic
1049303465 8:141884084-141884106 GCCAGGCTGTGCCTTTTCACAGG - Intergenic
1050445824 9:5721653-5721675 GCTTGAAAGTGGGTTTTCACTGG + Intronic
1050482014 9:6097292-6097314 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1052552562 9:29969872-29969894 GCCTGAAGGTGGGGTTTCACCGG + Intergenic
1053357886 9:37462345-37462367 GCTTGGAGGTGGGGTTTCACTGG - Intronic
1053476357 9:38384776-38384798 GCTTGGAGGTGGGATTTCACTGG - Intergenic
1056133155 9:83605184-83605206 GCCAGGACTGGGGTTTTGAGAGG - Intergenic
1056619101 9:88195636-88195658 GCCAGGATGTGGGCTATCATGGG - Intergenic
1059204910 9:112455472-112455494 GCCAGGACTAGGCTTTTGACAGG - Intronic
1060230725 9:121823244-121823266 GCCAGGAGCTGGGTTTTAATGGG - Intronic
1061044110 9:128155151-128155173 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1061727067 9:132587808-132587830 GGCAGGACTTGGATTTTCAGTGG - Intronic
1062412792 9:136433370-136433392 GCCAGGTCGTGGGGTTTCCCTGG - Intronic
1062485250 9:136771292-136771314 CCCAGGACGTGGGTAGTAACTGG - Intergenic
1186311355 X:8323065-8323087 GCTTGGAGGTGGGGTTTCACTGG - Intergenic
1187021959 X:15393031-15393053 GCAAGGACTTGGGTTTTAAATGG - Intronic
1188660268 X:32750610-32750632 GCTTGGAAGTGGGGTTTCACTGG - Intronic
1191754223 X:64576910-64576932 GCCTGGAGATGGGGTTTCACTGG - Intergenic
1193486134 X:82087100-82087122 GCTTGGAGGTGGGGTTTCACTGG + Intergenic
1200034134 X:153317501-153317523 GACAGGATGTTGGTTTTCATGGG - Intergenic
1200705402 Y:6438398-6438420 GTCTGGCCGTGGGTTATCACAGG - Intergenic
1201028709 Y:9726310-9726332 GTCTGGCCGTGGGTTATCACAGG + Intergenic