ID: 1154344176

View in Genome Browser
Species Human (GRCh38)
Location 18:13528554-13528576
Sequence CTTTGGAAGGTGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148242
Summary {0: 5, 1: 125, 2: 2466, 3: 32371, 4: 113275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154344176_1154344181 -8 Left 1154344176 18:13528554-13528576 CCACCCACCTTCACCTTCCAAAG 0: 5
1: 125
2: 2466
3: 32371
4: 113275
Right 1154344181 18:13528569-13528591 TTCCAAAGTGCTGAGATTACAGG 0: 700
1: 27611
2: 320125
3: 256339
4: 139939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154344176 Original CRISPR CTTTGGAAGGTGAAGGTGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr