ID: 1154346786

View in Genome Browser
Species Human (GRCh38)
Location 18:13549235-13549257
Sequence GGGCATTTAAACTGCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154346786_1154346791 26 Left 1154346786 18:13549235-13549257 CCCTGCTGGCAGTTTAAATGCCC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1154346791 18:13549284-13549306 AAGAAGTTGGAGTTTTGTTTAGG 0: 1
1: 0
2: 2
3: 40
4: 388
1154346786_1154346790 13 Left 1154346786 18:13549235-13549257 CCCTGCTGGCAGTTTAAATGCCC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1154346790 18:13549271-13549293 AAACATTCTTAATAAGAAGTTGG 0: 1
1: 0
2: 5
3: 53
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154346786 Original CRISPR GGGCATTTAAACTGCCAGCA GGG (reversed) Intronic
903891234 1:26571913-26571935 GGGCACTCACCCTGCCAGCATGG - Exonic
905537121 1:38730952-38730974 GGGCCTTTAAGATGCCAGTAAGG + Intergenic
906146190 1:43562012-43562034 GGGCATTTAAACCGCCATCCTGG - Intronic
910838636 1:91540314-91540336 GGGCATTCTGACTGCCAGCCTGG + Intergenic
911538064 1:99124468-99124490 GCACATTTAAAATGGCAGCAGGG + Intergenic
912143116 1:106756177-106756199 GGGCAATGGAGCTGCCAGCAAGG + Intergenic
912690431 1:111800817-111800839 GGGCTTTCTACCTGCCAGCATGG - Intronic
918338177 1:183542592-183542614 ATGCATTTAAACTTCCAGGACGG - Intronic
922872413 1:228913943-228913965 AGCCATTTAACCTGCCAGGATGG + Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1073062864 10:100742653-100742675 GGGCATTTACACTTCAAACAAGG - Intronic
1074248107 10:111714439-111714461 GGCCGAGTAAACTGCCAGCAGGG - Intergenic
1076781443 10:132726982-132727004 TGGCATTGAAAGTGCCAGTAAGG - Intronic
1077797987 11:5510980-5511002 GGGCATTTTAAATGCAAGAAAGG + Intronic
1092302008 12:7260285-7260307 GAGAACTTAACCTGCCAGCATGG + Intergenic
1094268438 12:28585122-28585144 GGGCTTTTAAATTGCCTCCAGGG + Intergenic
1099383695 12:81987754-81987776 GGGCATTTAAGCTGGCTGTAGGG + Intergenic
1105440862 13:20414846-20414868 GGGCATTTCCACTGTCAGGAGGG + Intronic
1105627410 13:22126158-22126180 GGGCATATAACCTGCCTCCATGG + Intergenic
1110506140 13:76289211-76289233 AGTCATTTAAAATGCCACCATGG + Intergenic
1112239143 13:97663864-97663886 GAGTATTTAAACTGCAGGCAAGG + Intergenic
1112289282 13:98130697-98130719 GGGCAAGCGAACTGCCAGCAAGG - Intergenic
1112846398 13:103648468-103648490 GGTTATTTCCACTGCCAGCATGG - Intergenic
1113890106 13:113731207-113731229 GGCCATGAAACCTGCCAGCAAGG - Exonic
1115250827 14:31345117-31345139 GGGCATTCAAACAGCGACCAAGG + Exonic
1119693993 14:76698263-76698285 GGGCCTTCACACTGCCAGCTGGG - Intergenic
1124812942 15:32960051-32960073 TGGCATTTAAAAAGCCAGCCTGG + Intronic
1129299389 15:74616482-74616504 GGGGATTTGAACTGTCAGCTTGG - Intronic
1132926076 16:2429666-2429688 GGGCATTTAAACCGCGCGCCCGG - Intronic
1149906221 17:60528789-60528811 GAGCAGATAAACTGCCAGAAAGG + Intergenic
1151459361 17:74245572-74245594 GGCCATTTAATCTCCCAGCTGGG + Intronic
1151668958 17:75561131-75561153 GAGAATTTAAACTGCCAAAAGGG - Intronic
1154346786 18:13549235-13549257 GGGCATTTAAACTGCCAGCAGGG - Intronic
1155132051 18:22945866-22945888 AGGCATTGAAACTGCAAGGAAGG - Intronic
1161817659 19:6509707-6509729 GGGCATTGACACAGCCAGCATGG + Intergenic
1162150239 19:8639910-8639932 GGGCTTTTAAACACCCAGCAGGG - Intergenic
1163121849 19:15223106-15223128 GGGCTCTGACACTGCCAGCAGGG - Intergenic
926734294 2:16060952-16060974 AAGCACTTAAACTGCCATCATGG - Intergenic
932452915 2:71827258-71827280 GGACTTGTAAACTGCTAGCATGG - Intergenic
933194578 2:79373850-79373872 GAGCATTTAAGCAGCCAGCCTGG + Intronic
934775157 2:96932634-96932656 TGTCTTTTAAAATGCCAGCATGG + Intronic
935173352 2:100627875-100627897 GTGCAATTAAACAGCCAGCCTGG + Intergenic
940011262 2:149058035-149058057 GGGCATTTCGACTGGCAGCCAGG + Intronic
947245429 2:228042202-228042224 GAGCACTTAACCTGCCTGCATGG + Intronic
947390507 2:229634843-229634865 GGGCATTTCAGGTGCCAGAAGGG - Intronic
1173370660 20:42431995-42432017 AGGCATTGCAACTGACAGCATGG + Intronic
1177450276 21:21257390-21257412 GGACATTTTATCTGCCATCAAGG - Intronic
953531891 3:43746853-43746875 GGGGATTTAAATTGGGAGCAAGG + Intergenic
953890154 3:46745282-46745304 GAACATTCAAAGTGCCAGCAGGG + Intronic
954457198 3:50606242-50606264 GGCCAGTTAGACTGCCTGCAGGG - Intergenic
961152760 3:124653559-124653581 GGCCATTTAAAATTGCAGCATGG - Intronic
966009539 3:175057523-175057545 GGGCTTATAAACTGTCAACAGGG - Intronic
970542836 4:17096455-17096477 GGGCTTCTGAACTGTCAGCAGGG - Intergenic
974625572 4:64423278-64423300 GCGCATTTAAACTGTCTGCTTGG - Intergenic
977317364 4:95467133-95467155 GAGCAGTTAACCTGTCAGCAGGG - Intronic
977634200 4:99277239-99277261 GGTCTTTTAAACTTCCAGCATGG - Intronic
985086231 4:186315754-186315776 GAGCATTAAAAATGCCAGAAGGG + Intergenic
986693187 5:10330843-10330865 TGGCCTTTAAAGTGCCAGCAAGG + Intergenic
989236398 5:39153269-39153291 GGGTATTTGCACTGCCAGCTTGG + Intronic
994203792 5:97009252-97009274 GGGCATCTAAACTGTCTTCAGGG - Intronic
995393386 5:111663220-111663242 TGGGATTCAAACTGCCAGGAGGG - Intronic
998023345 5:138790202-138790224 ATGCATGTTAACTGCCAGCAGGG + Intronic
1001879070 5:175227320-175227342 GGGCCTTTAAACTCCTAACATGG + Intergenic
1004199042 6:13531135-13531157 GGGCATTTAAAAACCCAGTAGGG + Intergenic
1007926149 6:45651321-45651343 GGGCATTAAAAGTGCCTGGATGG + Intronic
1009995409 6:70890266-70890288 AGGCATTTAAAGTGACTGCAGGG - Intronic
1011757243 6:90512731-90512753 GAGCATTTAAAATTACAGCATGG + Intergenic
1012034056 6:94109025-94109047 TGGCATTTAAACTCCCAACAAGG - Intergenic
1015970974 6:138742077-138742099 GGGTATAGACACTGCCAGCAGGG - Intergenic
1016300759 6:142628762-142628784 TTGCATCTAAACTGCCTGCACGG + Intergenic
1017407929 6:154139897-154139919 GGGAATTTAAACTGCGGGCCAGG - Intronic
1019887832 7:3920641-3920663 CGGCACTTAAACTGCAAGCTGGG + Intronic
1020382711 7:7564717-7564739 GGCCATTGAAACTGGCAGCATGG + Intergenic
1024349904 7:48353058-48353080 AGGCATTAAAACAGCCATCAGGG + Intronic
1024680099 7:51677443-51677465 GGACATATAAATGGCCAGCAGGG + Intergenic
1024943298 7:54784171-54784193 GGTCTTTTAAAGTGCCATCATGG + Intergenic
1032781997 7:135170867-135170889 CGGCATTACCACTGCCAGCATGG - Intergenic
1032985004 7:137328132-137328154 GGGTCTTTAATCTGGCAGCATGG - Intronic
1036428679 8:8669660-8669682 GGGCATTTAAACAGCAAAAATGG + Intergenic
1039137032 8:34336604-34336626 TGGAATTTAAACTAACAGCATGG + Intergenic
1042807981 8:72792538-72792560 TGGCATTTAAACTGGTTGCATGG + Intronic
1043052232 8:75398269-75398291 GGGCAGCTAAACTGCCATCAGGG - Intergenic
1043422238 8:80110041-80110063 GGGCATTCAAACTGCAAACCAGG + Intronic
1046787217 8:118280880-118280902 GGTCACTTAAACTGAAAGCATGG - Intronic
1050426516 9:5517264-5517286 GGACATGTACACTGGCAGCAAGG + Intronic
1057416506 9:94868477-94868499 GGGCATTTTGACTGCTAGTATGG + Intronic
1059314559 9:113412901-113412923 GGGTATTTTATCTGCCTGCATGG + Intronic
1062273195 9:135719095-135719117 GGGCAGTGAGACTGTCAGCATGG - Intronic
1062331274 9:136045965-136045987 GGGCATCTGAACGTCCAGCAGGG - Intronic
1187736338 X:22307879-22307901 GGCCTTTTAAACTGCCAGTGAGG - Intergenic
1194667863 X:96695320-96695342 GAAAATCTAAACTGCCAGCATGG - Intronic
1197749451 X:129954630-129954652 TGGCATTTACAAAGCCAGCAGGG - Intergenic
1198075645 X:133190651-133190673 GGGCCATTAGACTGCCAGGAAGG - Intergenic
1201295529 Y:12460047-12460069 GGCCATTACAAATGCCAGCATGG + Intergenic