ID: 1154352150

View in Genome Browser
Species Human (GRCh38)
Location 18:13593138-13593160
Sequence ATGTACTTTTAGTAGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248884
Summary {0: 1, 1: 24, 2: 2553, 3: 74290, 4: 172016}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154352150_1154352158 28 Left 1154352150 18:13593138-13593160 CCCTGACTCTACTAAAAGTACAT 0: 1
1: 24
2: 2553
3: 74290
4: 172016
Right 1154352158 18:13593189-13593211 TGTAATCCCAGCTACCGAGGAGG 0: 18
1: 2078
2: 68305
3: 213864
4: 273762
1154352150_1154352154 -3 Left 1154352150 18:13593138-13593160 CCCTGACTCTACTAAAAGTACAT 0: 1
1: 24
2: 2553
3: 74290
4: 172016
Right 1154352154 18:13593158-13593180 CATAAATTAGCCGGACATGGTGG 0: 3
1: 523
2: 14629
3: 86138
4: 178612
1154352150_1154352153 -6 Left 1154352150 18:13593138-13593160 CCCTGACTCTACTAAAAGTACAT 0: 1
1: 24
2: 2553
3: 74290
4: 172016
Right 1154352153 18:13593155-13593177 GTACATAAATTAGCCGGACATGG 0: 1
1: 22
2: 987
3: 16895
4: 75744
1154352150_1154352156 25 Left 1154352150 18:13593138-13593160 CCCTGACTCTACTAAAAGTACAT 0: 1
1: 24
2: 2553
3: 74290
4: 172016
Right 1154352156 18:13593186-13593208 GCCTGTAATCCCAGCTACCGAGG 0: 67
1: 6848
2: 127836
3: 263179
4: 233380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154352150 Original CRISPR ATGTACTTTTAGTAGAGTCA GGG (reversed) Intronic
Too many off-targets to display for this crispr