ID: 1154353113

View in Genome Browser
Species Human (GRCh38)
Location 18:13603643-13603665
Sequence CACTGAGATGGCGCTTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 572}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154353113_1154353115 -1 Left 1154353113 18:13603643-13603665 CCACAGGAAGCGCCATCTCAGTG 0: 1
1: 0
2: 0
3: 23
4: 572
Right 1154353115 18:13603665-13603687 GTTAGTTGTTGTCAGTATTTAGG 0: 1
1: 0
2: 3
3: 50
4: 395
1154353113_1154353116 4 Left 1154353113 18:13603643-13603665 CCACAGGAAGCGCCATCTCAGTG 0: 1
1: 0
2: 0
3: 23
4: 572
Right 1154353116 18:13603670-13603692 TTGTTGTCAGTATTTAGGTTAGG 0: 1
1: 0
2: 2
3: 30
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154353113 Original CRISPR CACTGAGATGGCGCTTCCTG TGG (reversed) Intronic
900573669 1:3372483-3372505 CACAGAGAAACCGCTTCCTGTGG + Intronic
900818160 1:4866441-4866463 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
902111128 1:14079147-14079169 CAATGAGCTGACGCTTCCTGAGG - Intergenic
903659029 1:24965743-24965765 CACCGAGAAGGGCCTTCCTGTGG + Intergenic
905603105 1:39270903-39270925 CACTAAGATGGGGCTGTCTGTGG - Intronic
906028404 1:42696219-42696241 CACTGCGAAGGTACTTCCTGGGG - Exonic
906361441 1:45163108-45163130 CTCTGAGATGAAGCTTCCAGAGG + Intronic
906571695 1:46846905-46846927 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
906777061 1:48539378-48539400 CACAGGGATGGGGCTTGCTGGGG - Intronic
907623926 1:56010284-56010306 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
908821603 1:68092960-68092982 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
908865961 1:68548527-68548549 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
908913665 1:69101882-69101904 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
909682737 1:78310801-78310823 CTCTGAGATGAAGCTTCCAGAGG + Intronic
910928473 1:92419876-92419898 CACTGGGGTGGAGCTTCATGAGG - Intergenic
911054043 1:93695710-93695732 CTCTGAAATTGCGCTCCCTGAGG + Intronic
911217902 1:95216068-95216090 CTCTGAGATGAAGCTTCCAGAGG - Intronic
911339205 1:96617220-96617242 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
911963581 1:104337725-104337747 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
912280160 1:108304559-108304581 CCCTGAGATGGAGCTCCCAGAGG - Intergenic
912288066 1:108389798-108389820 CCCTGAGATGGAGCTCCCAGAGG + Intronic
912363043 1:109110856-109110878 CACTGAAATGGGGCATCCTGGGG - Intronic
912392619 1:109314918-109314940 CACTGAGATGGTTCATCTTGGGG - Intronic
912786490 1:112608827-112608849 CACTTAAATGGTGCTTCCTCAGG + Intronic
912795342 1:112689750-112689772 CCTTGGGATGGGGCTTCCTGGGG + Intronic
913033190 1:114933184-114933206 CTCTGAGATGAAGCTTCCAGAGG + Intronic
913710496 1:121477898-121477920 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
914414693 1:147469028-147469050 CACTGGGATGGAGTTTCCAGAGG - Intergenic
915763301 1:158336859-158336881 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
915886865 1:159731215-159731237 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
916032859 1:160893294-160893316 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
916251929 1:162746757-162746779 CTCTGAGATGAAGCTTCCAGAGG + Intronic
917289911 1:173461225-173461247 CCCTGGGATGGAGCTTCCAGGGG + Intergenic
919065428 1:192688079-192688101 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
919554662 1:199035652-199035674 CACTGGAATGTAGCTTCCTGAGG + Intergenic
919603237 1:199648100-199648122 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
919760919 1:201097534-201097556 CACAGAGCTGGTGCTCCCTGTGG - Intronic
919795434 1:201318845-201318867 GGCTGAGATGGGGCTGCCTGGGG - Intronic
919929182 1:202210112-202210134 GACTGAGATGTCTCTTCCTCTGG + Intronic
920085472 1:203412247-203412269 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
920237054 1:204515017-204515039 CACTGAGATGGAGCTTTCTTGGG + Intergenic
922762888 1:228143283-228143305 CACTGAGCTGGCCCTTCTTAAGG - Intronic
923153521 1:231255821-231255843 CACTGTCATGGCTCTTTCTGAGG + Intronic
924130308 1:240900646-240900668 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1063953201 10:11243034-11243056 CAGTGAGCTGGAGCTTCTTGAGG - Intronic
1065402412 10:25320497-25320519 CATTGAGATGGCCTTTCCAGTGG + Intronic
1065473011 10:26102753-26102775 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1066140743 10:32501703-32501725 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1066163062 10:32755405-32755427 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1066509689 10:36082929-36082951 CCCTCAGATGGAGCTTCCAGAGG - Intergenic
1067199171 10:44151751-44151773 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1067783669 10:49227287-49227309 CACTCAGATGGGGCTGCCTCAGG + Intergenic
1067996664 10:51281214-51281236 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1068641530 10:59413673-59413695 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1068821170 10:61378708-61378730 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1069057184 10:63857045-63857067 CCCTGAGATGAAGCTTCCAGAGG - Intergenic
1069188943 10:65463781-65463803 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1070054667 10:72923608-72923630 CACTGGGATGGAGCTCCCAGAGG - Intronic
1071421452 10:85504430-85504452 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1072361339 10:94662919-94662941 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1072775000 10:98182398-98182420 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1072929141 10:99645914-99645936 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1073010529 10:100355810-100355832 GACTGAGAAAGGGCTTCCTGAGG + Intronic
1075858119 10:125648291-125648313 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1075902403 10:126053678-126053700 TACTGAGATGACGTTTCCTTTGG + Intronic
1076589286 10:131572079-131572101 CATTGACATGGCTGTTCCTGTGG - Intergenic
1076590886 10:131581331-131581353 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1076665999 10:132093121-132093143 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1079342483 11:19624120-19624142 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1079425785 11:20341238-20341260 GACTTAGATGGCCCTTCTTGAGG - Intergenic
1079909568 11:26292788-26292810 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1080292652 11:30688227-30688249 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
1080917463 11:36674178-36674200 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1082860280 11:57848611-57848633 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1082938648 11:58680446-58680468 CCCTGAGATGGAGCTCCCAGAGG + Intronic
1083124546 11:60551134-60551156 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1083190294 11:61046820-61046842 CAAGGACATGGCGATTCCTGAGG + Intergenic
1083494717 11:63041639-63041661 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1083681587 11:64354127-64354149 CCCGGAGACGGAGCTTCCTGAGG + Exonic
1084558547 11:69889742-69889764 CAATGCGAAAGCGCTTCCTGTGG - Intergenic
1084717400 11:70882741-70882763 CACAGAGGTGGCCTTTCCTGTGG - Intronic
1085447997 11:76614277-76614299 CACTGAGATGGGGCATGATGTGG + Intergenic
1087051056 11:93886876-93886898 CACAGAGATGGTGCCTCCTGGGG + Intergenic
1091442432 12:521823-521845 CACTGAGCTGGAGCTTCCATGGG + Intronic
1091867325 12:3851893-3851915 CTCTGAGACGAAGCTTCCTGAGG + Intronic
1092079061 12:5698235-5698257 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1092517078 12:9226068-9226090 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1092560828 12:9611094-9611116 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1093082731 12:14831853-14831875 CACTGAGATGGAGAAGCCTGGGG - Intronic
1093902729 12:24654416-24654438 CTCTGGGATGAAGCTTCCTGAGG - Intergenic
1093988384 12:25563497-25563519 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1095845324 12:46737737-46737759 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1095883492 12:47164499-47164521 CATTGAGGTGGGGCTTTCTGAGG - Intronic
1095913873 12:47457152-47457174 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1097917415 12:65035807-65035829 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1098128312 12:67322739-67322761 CCCTGAAATGGAGCTCCCTGGGG + Intergenic
1099025531 12:77460043-77460065 CCCTGAGATGAAGCTTCCAGAGG + Intergenic
1099806961 12:87531720-87531742 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1100038513 12:90282187-90282209 CACAGAGGTGGAGCTTCCTAAGG + Intergenic
1100375069 12:94007675-94007697 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1100411435 12:94323046-94323068 CTCTGAGATGGAGCTCCCAGAGG - Intronic
1100750801 12:97696672-97696694 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1100896345 12:99186515-99186537 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1100907721 12:99321057-99321079 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1101884783 12:108652908-108652930 CCATGAGATGGCACTTTCTGAGG - Intronic
1103119852 12:118372025-118372047 CACTGTCTTGGCCCTTCCTGGGG + Intronic
1103255562 12:119539056-119539078 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1104086348 12:125477873-125477895 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1104829225 12:131737179-131737201 CACCGGAATGGCTCTTCCTGAGG + Intronic
1106387639 13:29302922-29302944 CCCTGGGATGGAGCTTCCAGAGG + Intronic
1106578980 13:31001328-31001350 CTCTGACATGGCACTTACTGTGG + Intergenic
1107090429 13:36473639-36473661 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1107207370 13:37808900-37808922 CACTTAGATGGCGGTTTCAGGGG - Intronic
1107507291 13:41047631-41047653 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1108107206 13:47024208-47024230 CACTGTTATGGCGCTTCTTTTGG + Intergenic
1108264971 13:48697298-48697320 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1108471686 13:50773635-50773657 CACTGAGATGAAGCTTCCAGAGG - Intronic
1108800813 13:54092616-54092638 CTCTGAGATGGAGCTCCCAGAGG - Intergenic
1109187995 13:59292476-59292498 CTCTGGGATGGAGCTTCCAGAGG + Intergenic
1111071343 13:83171929-83171951 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1111355132 13:87089591-87089613 CACTGGGAAGCCGTTTCCTGAGG - Intergenic
1112612499 13:100969551-100969573 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1112972095 13:105273479-105273501 CCCTGAGATGGAGCTCCCAGAGG - Intergenic
1113276861 13:108740487-108740509 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1114394976 14:22349696-22349718 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1114681961 14:24492202-24492224 CTCTGAGATGGAGCTTCCAGAGG + Intergenic
1115135925 14:30107714-30107736 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1115184008 14:30664159-30664181 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1116474605 14:45325589-45325611 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1116489112 14:45485978-45486000 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1116736476 14:48697932-48697954 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1117820545 14:59644719-59644741 CCCTGAGATGGAGCTCCCAGAGG + Intronic
1117829330 14:59734004-59734026 CCCTGGGATGGAGCTTCCAGAGG + Intronic
1118105690 14:62657035-62657057 CACAGAGATGGAGCTTCCCTTGG - Intergenic
1118146589 14:63144335-63144357 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1118415141 14:65527901-65527923 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1118463856 14:66013495-66013517 CACTGCGAAGGTACTTCCTGGGG + Intergenic
1119093509 14:71806953-71806975 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1120283159 14:82464253-82464275 CCCTGAGATGGAGATTCCAGAGG + Intergenic
1120778194 14:88461061-88461083 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1121498274 14:94412874-94412896 CACTGAAAAGGCACTTTCTGAGG - Intergenic
1121988332 14:98529646-98529668 CACTGGGATGGCTGTCCCTGTGG - Intergenic
1122952359 14:105052086-105052108 CACTGGGGTGGCGTTTCCTGTGG + Exonic
1123127730 14:105961472-105961494 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1123408196 15:20037285-20037307 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1123517520 15:21043939-21043961 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1124419272 15:29505532-29505554 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1125232177 15:37468927-37468949 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1125330976 15:38581489-38581511 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1125779434 15:42251608-42251630 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1127038325 15:54944812-54944834 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1127339611 15:58027159-58027181 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1127373817 15:58363680-58363702 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1128371885 15:67045807-67045829 CACTGAACTGGTACTTCCTGAGG - Intergenic
1128874135 15:71188352-71188374 CACCTAGATGGAGCTTCCTCTGG + Intronic
1130364534 15:83222305-83222327 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1131103001 15:89708672-89708694 CACTGGGAAAGCACTTCCTGGGG - Intronic
1131374123 15:91909602-91909624 AACTGAGCAGGCTCTTCCTGGGG - Intronic
1132097591 15:98999271-98999293 CACTGACATGTCTCTTCATGTGG - Intronic
1132139662 15:99381883-99381905 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1135007757 16:18842340-18842362 CACTGAAATTGCTCTTCCTGGGG - Exonic
1135109328 16:19678377-19678399 GATTCAGATGGCGCTTCCAGTGG - Intronic
1135301704 16:21334395-21334417 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1136065466 16:27755384-27755406 CCCTGAGATGGAGTTTCCTGGGG + Intronic
1137471139 16:48759473-48759495 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1137680941 16:50344051-50344073 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1137808601 16:51330584-51330606 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1137907128 16:52334181-52334203 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1138713150 16:58992608-58992630 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1139105324 16:63820448-63820470 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1140054085 16:71510535-71510557 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1140477286 16:75245300-75245322 CACTCTGCTGGCACTTCCTGTGG - Intronic
1142228515 16:88888744-88888766 CTCTGACATGGCGCTTCTAGGGG - Intronic
1143347307 17:6259398-6259420 CACTGAGATGGAGGTAACTGTGG + Intergenic
1143927430 17:10384135-10384157 CACTAAGATGCCGCTTCCGGAGG - Intergenic
1145718926 17:27049960-27049982 CTCTGAGATGGAGCTTTCAGGGG + Intergenic
1145960218 17:28882793-28882815 CTCTGAGCTGGGTCTTCCTGGGG + Intronic
1146312661 17:31781171-31781193 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1146729969 17:35184808-35184830 TTCTGACATGGGGCTTCCTGGGG + Intronic
1148847122 17:50535947-50535969 CTCTTAGGTGGGGCTTCCTGGGG + Intronic
1149359478 17:55878674-55878696 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1149649573 17:58268531-58268553 CACTGAGATGGCGCGTGCGTGGG + Intergenic
1152261917 17:79271963-79271985 CACTGAGCTGGCCCTTCCCGCGG + Intronic
1152429045 17:80237223-80237245 AACTGAGATGTCCGTTCCTGAGG - Intronic
1153402435 18:4695438-4695460 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1153785267 18:8528790-8528812 CCCTGGGATGGTGCTTCCAGAGG + Intergenic
1153827488 18:8889428-8889450 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1154019563 18:10650746-10650768 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1154184651 18:12172478-12172500 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1154329827 18:13420873-13420895 CACTGAGATGCTGAGTCCTGAGG - Intronic
1154353113 18:13603643-13603665 CACTGAGATGGCGCTTCCTGTGG - Intronic
1154470221 18:14693402-14693424 CTCTGAGATGGAGCTTTCAGGGG - Intergenic
1155006776 18:21736153-21736175 CTCTGGGATGGAGCTTCCAGAGG + Intronic
1155126849 18:22886159-22886181 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1155231121 18:23776139-23776161 TACTGAGATGGCAATTTCTGTGG - Intronic
1155784994 18:29884564-29884586 CACTGAGATGGAGCCTCCTCGGG - Intergenic
1157123361 18:44933304-44933326 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1158101344 18:53833717-53833739 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1158832422 18:61294587-61294609 CACTTAGATGGTGCTTGTTGTGG - Intergenic
1159199627 18:65167149-65167171 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1159364715 18:67450968-67450990 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1159592267 18:70348297-70348319 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1159627856 18:70715081-70715103 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1160285331 18:77537503-77537525 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1162385137 19:10356550-10356572 CACTGGGATGGAGCTCACTGTGG + Exonic
1162743823 19:12788372-12788394 CACTTACATGGCTCTTACTGTGG - Intronic
1163975995 19:20852810-20852832 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1164091389 19:21956189-21956211 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1164111185 19:22160879-22160901 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1164248553 19:23457092-23457114 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1164495586 19:28757620-28757642 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1164542810 19:29133362-29133384 CTCTGGGATGACGCTTCCAGAGG + Intergenic
1164667759 19:30052703-30052725 CCCTGAGATGGAGGATCCTGTGG + Intergenic
1168210032 19:54883629-54883651 CACTGAGATGGCAGATCATGTGG - Intronic
925673104 2:6332887-6332909 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
929401139 2:41582761-41582783 CCCTGAGATGGAGCTTCCAAAGG + Intergenic
929881739 2:45842801-45842823 CACTGGGATGGTGCTACCTATGG + Intronic
931491622 2:62754344-62754366 CTCTGAGATGAGGCTTCCAGAGG - Intronic
931698800 2:64891798-64891820 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
931860747 2:66352231-66352253 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
932019142 2:68064530-68064552 CTCTGAGATGAAGCTTCCAGAGG + Intronic
932377488 2:71250774-71250796 CTCTGGGATGACGCTTCCAGAGG - Intergenic
932379677 2:71270469-71270491 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
933202501 2:79466666-79466688 CTCTGAGACGGAGCTTCCAGAGG + Intronic
933366654 2:81362324-81362346 CCCTGAGATGAAGCTTCCAGAGG - Intergenic
934637289 2:96001717-96001739 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
934796361 2:97103690-97103712 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
934994713 2:98947074-98947096 CACTTAGATGAAGCTACCTGGGG + Intergenic
934999717 2:99001257-99001279 CTCTGAGATGAAGCTTCCAGAGG + Intronic
935763607 2:106343488-106343510 CACTGAGAGGGCGCCTCCCAGGG + Intergenic
936857917 2:116982294-116982316 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
937074967 2:119096496-119096518 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
938086876 2:128407559-128407581 CACTGAGCTGGCCCTGGCTGAGG + Intergenic
938217538 2:129532665-129532687 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
938303298 2:130230997-130231019 CCCGGAGCTGGCGCTGCCTGTGG + Intergenic
938453374 2:131443240-131443262 CCCGGAGCTGGCGCTGCCTGTGG - Intergenic
938987859 2:136596826-136596848 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
939365016 2:141219702-141219724 CTCTGAGATGGAGCTCCCAGAGG + Intronic
939730897 2:145783146-145783168 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
939974850 2:148705609-148705631 CCCTGAGATGAAGCTTCCAGAGG + Intronic
940124677 2:150310297-150310319 CACTGAAATGGAGCTTTCAGAGG + Intergenic
940174485 2:150863561-150863583 CATGGGGATGGGGCTTCCTGAGG - Intergenic
940257284 2:151744109-151744131 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
940691603 2:156926152-156926174 CACAGAGATGGGGCTTCCCAAGG - Intergenic
940705719 2:157102635-157102657 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
943299942 2:186186232-186186254 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
943512399 2:188841402-188841424 CACTGGGATGAAGCTTCCAGAGG + Intergenic
943946637 2:194073809-194073831 CTCTGAGATGTAGCTTCCAGAGG - Intergenic
944052961 2:195491996-195492018 GAATGAGATGGCTCTCCCTGGGG - Intergenic
944307786 2:198197020-198197042 CTCTGAGATGAAGCTTCCAGAGG + Intronic
944520933 2:200566423-200566445 CTCTGAGATGAAGCTTCCAGAGG - Intronic
944983903 2:205153140-205153162 CTCTGAGATGAAGCTTCCAGAGG - Intronic
945343485 2:208685718-208685740 CTCTGAGATGAAGCTTCCAGAGG - Intronic
945615014 2:212055567-212055589 CGCTGAGATGAAGCTTCCAGGGG + Intronic
945930283 2:215848038-215848060 CTATGAGCAGGCGCTTCCTGAGG + Intergenic
1169307029 20:4501195-4501217 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1170752786 20:19167037-19167059 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1171081905 20:22194883-22194905 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1171352366 20:24512915-24512937 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1172182744 20:33013658-33013680 GAGTGAGATGGCCCTACCTGGGG - Intronic
1173232050 20:41205934-41205956 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1176804274 21:13464463-13464485 CTCTGAGATGGAGCTTTCAGGGG + Intergenic
1176915624 21:14621913-14621935 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1176928515 21:14779652-14779674 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1177273555 21:18877828-18877850 CCCTGAGATGGGGCTCCCAGGGG - Intergenic
1178345112 21:31819576-31819598 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1178910362 21:36668902-36668924 CGCTGAGATGGGGCTTGGTGGGG - Intergenic
1180598401 22:16995588-16995610 CTCTGGGATGACGCTTCCAGAGG + Intronic
1180878119 22:19184773-19184795 CACTGACTGGGAGCTTCCTGGGG - Intronic
1181013030 22:20053354-20053376 CACTGATATGGGGCCCCCTGGGG - Intronic
1181714394 22:24713591-24713613 CACTCAGGTGGCTCTTCCTCAGG - Intergenic
950792572 3:15485251-15485273 CTCTGAGATGAAGCTTCCAGAGG - Intronic
950862680 3:16164203-16164225 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
951206701 3:19933448-19933470 CACAGAGATTAAGCTTCCTGTGG - Exonic
951368363 3:21812982-21813004 CTCTGAGATGAAGCTTCCAGAGG + Intronic
951777163 3:26323435-26323457 CTCTGAGATGAAGCTTCCGGAGG - Intergenic
953073122 3:39543546-39543568 CACAGAGCAGGCACTTCCTGAGG + Intergenic
953867776 3:46599175-46599197 GATAGAGATGGCCCTTCCTGGGG + Intronic
954492646 3:50921908-50921930 CTCTGAGATGAAGCTTCCAGAGG - Intronic
955224033 3:57046582-57046604 CACTAAGATGCATCTTCCTGAGG - Intronic
956795537 3:72715688-72715710 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
956993358 3:74794852-74794874 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
958553608 3:95645803-95645825 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
959218475 3:103483523-103483545 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
959263950 3:104114231-104114253 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
959469248 3:106729100-106729122 CACTGATATTGTGCTTTCTGTGG + Intergenic
959534692 3:107471139-107471161 CTCTGGGATGGAGCTTCCAGAGG + Intergenic
960967396 3:123114739-123114761 CACTGAGGTGGCAGGTCCTGAGG + Intronic
961676275 3:128568923-128568945 TTCTGGGCTGGCGCTTCCTGAGG - Intergenic
962554023 3:136527937-136527959 CTCTGAGATGAAGCTTCCCGAGG - Intronic
962566788 3:136668738-136668760 CACTGGGAGGGAGCTGCCTGAGG + Intronic
962907557 3:139818591-139818613 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
963032097 3:140988344-140988366 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
963230446 3:142904346-142904368 AACTGAGGTGGCCCTACCTGTGG + Intergenic
963281804 3:143391240-143391262 CTCTGAGATGAAGCTTCCAGAGG + Intronic
963387871 3:144619976-144619998 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
963595152 3:147316988-147317010 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
963756080 3:149235982-149236004 CTCTGAGATGGAGCTTCCAAAGG + Intergenic
964100335 3:152980982-152981004 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
964155976 3:153584759-153584781 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
964260019 3:154825327-154825349 CACTGAGATGAAGCTTCCAGAGG - Intergenic
964588056 3:158329589-158329611 CTCTGAGATGAAGCTTCCAGAGG - Intronic
964707379 3:159633441-159633463 CACTGAGATGGTGTGCCCTGTGG - Intronic
965161539 3:165139731-165139753 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
965523329 3:169690530-169690552 CCCTGAGCTGGTGCTTCTTGTGG - Intergenic
966151918 3:176875091-176875113 CCCTGGGATGGAGCTTCCAGAGG - Intergenic
966463034 3:180198657-180198679 CACTCAGATGGCTATTCATGGGG - Intergenic
969425343 4:7120966-7120988 CACTGCGGTGGCTTTTCCTGTGG + Intergenic
971441774 4:26694682-26694704 CTCTGAGATGAAGCTTCCAGAGG + Intronic
971631050 4:28994326-28994348 CACTGAGATGTCACATCCTAAGG - Intergenic
971697970 4:29930415-29930437 CTCTGGGATGAAGCTTCCTGAGG + Intergenic
972012904 4:34206417-34206439 CACAGGCATGGAGCTTCCTGAGG + Intergenic
972173653 4:36377271-36377293 CACTGAGACGAAGCTTCCAGAGG + Intergenic
972312144 4:37891344-37891366 CACAGGTAAGGCGCTTCCTGGGG + Exonic
972685675 4:41350218-41350240 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
973254028 4:48091054-48091076 CACTGAGATAGAGCTCCCTGTGG - Intronic
973874797 4:55206678-55206700 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
974127588 4:57714875-57714897 CTCTGAGATGAAGCTTCCAGGGG + Intergenic
974307008 4:60155738-60155760 CACTGGGATGAAGCTTCCAGAGG - Intergenic
974347136 4:60696611-60696633 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
974358520 4:60844565-60844587 CACTGAGTTGGAGGTTCCTGTGG - Intergenic
974528459 4:63076726-63076748 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
974586806 4:63890318-63890340 CACTGAGATTATGCTTCCTCTGG - Intergenic
974937069 4:68420967-68420989 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
974954546 4:68622036-68622058 CTCTGAGATGAAGCTTCCAGAGG - Intronic
975522376 4:75314204-75314226 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
975753528 4:77549701-77549723 CTCTGAGATGAAGCTTCCAGAGG - Intronic
975998336 4:80341454-80341476 CACTGGGATGGAGCTCCCGGAGG + Intronic
976403913 4:84640023-84640045 CAATGATATGGCTATTCCTGTGG - Intronic
976790323 4:88870905-88870927 CTCTGAGATGAAGCTTCCAGAGG + Intronic
977006425 4:91572966-91572988 CCCTGAGATGGAGCTCCCAGAGG - Intronic
977219733 4:94325142-94325164 CTCTGAGATGAAGCTTCCAGAGG - Intronic
977633532 4:99269963-99269985 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
977774510 4:100901223-100901245 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
977928889 4:102730463-102730485 CACTGCGGGGGCGGTTCCTGGGG + Intronic
978012817 4:103708291-103708313 CTCTGAGATGAAGCTTCCAGAGG + Intronic
978140462 4:105312595-105312617 CACTGAGATGAAGCTTCCAGAGG - Intergenic
978694928 4:111565913-111565935 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
978756541 4:112309100-112309122 CTCTGAGATGAAGCTTCCAGAGG - Intronic
979044901 4:115851276-115851298 CCCTGAGATGGAGTTCCCTGGGG + Intergenic
979179522 4:117707804-117707826 CACTGAGTTGGATCTACCTGTGG + Intergenic
979462625 4:121001372-121001394 CTCTGGGATGACGCTTCCAGAGG - Intergenic
980503907 4:133690547-133690569 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
980645259 4:135635634-135635656 CCCTGGGATGGAGCTTCCAGAGG - Intergenic
980685362 4:136220272-136220294 CCCAGTGATGGTGCTTCCTGGGG - Intergenic
980848665 4:138354568-138354590 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
981514837 4:145596660-145596682 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
981560887 4:146047663-146047685 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
981606664 4:146547180-146547202 CCCTGAGATGGAGCTCCCAGTGG - Intergenic
981616113 4:146646681-146646703 CACTAAGCTGGTTCTTCCTGTGG - Intergenic
981668301 4:147255817-147255839 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
982397153 4:154925263-154925285 CCCTGGGATGGAGCTTCCAGAGG - Intergenic
982792983 4:159614765-159614787 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
983362464 4:166744242-166744264 CTCTGAGATGAAGCTTCCAGAGG + Intronic
983485806 4:168330728-168330750 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
983486974 4:168343747-168343769 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
983753545 4:171305141-171305163 CACTGTGATGGAGCTCCCAGAGG + Intergenic
983909621 4:173223077-173223099 TACTTAGATGGAGCTTCCTAAGG + Intronic
984015149 4:174417246-174417268 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
986287093 5:6367374-6367396 CACTGAGTTGGAGGTTCCTGGGG + Intergenic
986358620 5:6952884-6952906 CTCTGGGATGGAGCTTCCAGAGG + Intergenic
986663229 5:10077413-10077435 GGCTGAGATGGGTCTTCCTGTGG + Intergenic
988023604 5:25655206-25655228 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
988668191 5:33353516-33353538 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
988840217 5:35075826-35075848 CTCTGAGATGAAGCTTCCAGAGG + Intronic
989608151 5:43265977-43265999 CTCTGAGATGAAGCTTCCAGAGG - Intronic
989614676 5:43328234-43328256 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
989693168 5:44169966-44169988 CCCTGAGATGGAGCTCCCAGAGG + Intergenic
989784698 5:45313155-45313177 CTCTGAGATGAAGCTTCCAGAGG + Intronic
989966376 5:50470634-50470656 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
990164058 5:52975966-52975988 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
990230242 5:53705551-53705573 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
990541894 5:56781677-56781699 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
990704820 5:58515908-58515930 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
990750515 5:59010929-59010951 CTCTGAGATGAAGCTTCCAGAGG + Intronic
991097374 5:62753181-62753203 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
991387580 5:66106705-66106727 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
992183576 5:74222161-74222183 CGCTGAGATGAAGCTTCCAGAGG - Intergenic
992265363 5:75012989-75013011 TTCTGAGATGCAGCTTCCTGGGG + Intergenic
992631236 5:78682727-78682749 CTCTGAGATGAAGCTTCCAGAGG + Intronic
993619159 5:90147535-90147557 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
993947941 5:94137808-94137830 CTCTGGGATGATGCTTCCTGAGG - Intergenic
994143470 5:96367176-96367198 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
994609611 5:102019348-102019370 CACTGGGATGAAGCTTCCAGAGG + Intergenic
995179083 5:109213806-109213828 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
995329638 5:110933143-110933165 CATTGGGATGGAGCTTCCAGAGG - Intergenic
995391038 5:111640355-111640377 CACAGAGATGGAGCTTCCCAAGG + Intergenic
995471301 5:112504365-112504387 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
995690311 5:114818635-114818657 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
995694901 5:114867527-114867549 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
995747964 5:115423740-115423762 CACTGTGAGGGCCCTGCCTGGGG - Intergenic
996520858 5:124423907-124423929 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
996639934 5:125740223-125740245 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
996778545 5:127159467-127159489 CCCTGGGATGGAGCTTCCAGGGG - Intergenic
997612259 5:135223434-135223456 CACTGAGATGTCACCTCCTTGGG - Intronic
998541894 5:142990815-142990837 CTCTGAGATGAAGCTTCCAGAGG - Intronic
998780548 5:145651545-145651567 CTCTGAGATGAAGCTTCCAGAGG + Intronic
999432329 5:151535268-151535290 CAAAGAGATTGTGCTTCCTGAGG - Intronic
999477607 5:151915257-151915279 GGCTGAGATGGGGCATCCTGAGG + Intronic
999542342 5:152587128-152587150 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1000582140 5:163048003-163048025 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1001235965 5:170029889-170029911 AGCTGAGATGGCACTGCCTGGGG - Intronic
1001467645 5:171982768-171982790 CACCGAGATTCCGTTTCCTGAGG - Intronic
1002010207 5:176273220-176273242 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1002216515 5:177638893-177638915 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1004731003 6:18359130-18359152 CTCTGAGATGAGGCTTCCAGAGG - Intergenic
1005558207 6:27009170-27009192 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1005684027 6:28234658-28234680 CACTGAGAAAGAGCTTCCTCTGG - Intergenic
1006200048 6:32279990-32280012 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1007629236 6:43263529-43263551 AACTGAGAGGGCACTTCCTCTGG - Intronic
1007653574 6:43438475-43438497 GACTGAGATGGCAGCTCCTGAGG - Intronic
1007858227 6:44879703-44879725 CACTGGGATGAAGCTTCCAGAGG + Intronic
1008633232 6:53383487-53383509 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1009325642 6:62345399-62345421 CCCTGAGATGGAGCTTCCAGGGG + Intergenic
1009393322 6:63167737-63167759 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1010511757 6:76729241-76729263 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1010553573 6:77252295-77252317 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1010670127 6:78676721-78676743 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1011018208 6:82782092-82782114 CACAGGGATGGGGCTTCCTAAGG + Intergenic
1011283408 6:85700115-85700137 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1011332672 6:86227728-86227750 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1011408196 6:87038542-87038564 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1012608673 6:101188910-101188932 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1012739913 6:103003669-103003691 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1012799110 6:103802610-103802632 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1012933307 6:105339172-105339194 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1013387464 6:109645841-109645863 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1013929815 6:115516868-115516890 CACTGGGATGAAGCTTCCAGAGG + Intergenic
1014154221 6:118092651-118092673 CACAGAGGTGGAGCTTCCCGAGG + Intronic
1015430263 6:133123010-133123032 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1015723103 6:136266511-136266533 CACTAATTTGGTGCTTCCTGTGG - Intronic
1015901995 6:138076753-138076775 CCCTAAGATGGAGCTTCCAGAGG + Intergenic
1016175958 6:141077829-141077851 CCCTTAGATGGGGCTTGCTGTGG - Intergenic
1016847881 6:148587284-148587306 CCCTGGGATGGAGCTTCCAGAGG - Intergenic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1017439082 6:154446146-154446168 CACTGAGATCTCACTTCCTAGGG + Intronic
1018011209 6:159671382-159671404 CTCTGAGATGAAGCTTCCAGAGG + Exonic
1018080448 6:160255193-160255215 CCCTGACAAGGCTCTTCCTGGGG - Intronic
1018114036 6:160565311-160565333 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1018541601 6:164886199-164886221 CACTGAAATTGCTCTTGCTGAGG + Intergenic
1018620637 6:165726691-165726713 CACTGAGAACCAGCTTCCTGGGG + Intronic
1018740076 6:166721803-166721825 CTCTGAGCTGGCACCTCCTGGGG - Intronic
1018760035 6:166885597-166885619 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1020013842 7:4820076-4820098 CCCTGAGCTGACTCTTCCTGTGG + Intronic
1020551491 7:9611768-9611790 CATTGACATGGGCCTTCCTGGGG - Intergenic
1020622430 7:10533985-10534007 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1020867933 7:13590510-13590532 CACTGGGATGGAGCTCCCAGAGG - Intergenic
1021201799 7:17735471-17735493 CTCTGAGATGAAGCTTCCTGAGG + Intergenic
1022453654 7:30538254-30538276 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1022658568 7:32344598-32344620 CACTGAGAAGGTGCTATCTGAGG - Intergenic
1022986941 7:35664969-35664991 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1023044409 7:36198781-36198803 CACAGAGATGGCTCTTGCTGAGG - Intronic
1023651132 7:42370803-42370825 CTCTGGGATGGAGCTTCCAGAGG - Intergenic
1024205924 7:47160449-47160471 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1024666992 7:51557521-51557543 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1024913245 7:54470011-54470033 AACTGAGAGGCCGCTCCCTGGGG + Intergenic
1025524398 7:61786540-61786562 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1025547758 7:62198758-62198780 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1025640776 7:63366263-63366285 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1027871763 7:83716739-83716761 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1028022270 7:85791670-85791692 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1028078679 7:86547642-86547664 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1028228701 7:88279996-88280018 TACTAAGATGGTGCTTCTTGAGG - Intronic
1028395456 7:90364486-90364508 CCCTGAGATGAAGCTTCCAGAGG - Intronic
1028446372 7:90928575-90928597 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1029062338 7:97811096-97811118 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1030055796 7:105582922-105582944 CACTGCGAAGGTACTTCCTGGGG + Intronic
1030142679 7:106320938-106320960 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1030179364 7:106689722-106689744 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1030331668 7:108278100-108278122 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1030526420 7:110660470-110660492 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1030762051 7:113364349-113364371 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1030890681 7:114995697-114995719 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1031344650 7:120650967-120650989 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1032603971 7:133329788-133329810 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1034236872 7:149579152-149579174 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1034282325 7:149862932-149862954 GAATGTGATGGCGCTGCCTGGGG - Intronic
1034360895 7:150496861-150496883 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1034451767 7:151141001-151141023 CACTGAGGTGAGGCTGCCTGGGG + Intronic
1034583270 7:152065793-152065815 CTCTGAGATGACGCTTTCAGAGG - Intronic
1034703836 7:153122383-153122405 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1035558768 8:589422-589444 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1036646384 8:10613199-10613221 GACTGAGCTGGCGTGTCCTGAGG + Exonic
1036966414 8:13303265-13303287 ATCTGAGATGGGGCATCCTGGGG + Intronic
1037195643 8:16186193-16186215 CACTGAGATAGCACATCCAGGGG + Intronic
1038479553 8:27892484-27892506 CACTGTCATGGTGATTCCTGTGG + Intronic
1038515929 8:28187733-28187755 TACAGAGAGGGAGCTTCCTGCGG + Intronic
1038870531 8:31489164-31489186 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1039146284 8:34451101-34451123 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1039281429 8:35989654-35989676 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1039707369 8:40021749-40021771 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1040389994 8:46941486-46941508 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1040827227 8:51636981-51637003 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1041217642 8:55616494-55616516 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1041302760 8:56429873-56429895 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1042108702 8:65356234-65356256 CCTTGAGATGGAGCTTCCAGAGG - Intergenic
1042686966 8:71452558-71452580 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1042731389 8:71939198-71939220 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1042763115 8:72291819-72291841 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1042931359 8:74016644-74016666 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1043048708 8:75359212-75359234 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1043089135 8:75875765-75875787 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1043859185 8:85296175-85296197 TACTGAGATGGAGCATCCTTGGG - Intergenic
1043911850 8:85873627-85873649 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1044282838 8:90376210-90376232 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1044450899 8:92335248-92335270 CACAGGGATGGAGCTTCCAGAGG - Intergenic
1046524889 8:115371123-115371145 CTCTGAGATGACGCTTCCAGAGG + Intergenic
1046900864 8:119521778-119521800 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1047548012 8:125838820-125838842 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
1048935774 8:139355461-139355483 CACTGAGCTGCAGCTCCCTGTGG - Intergenic
1049209672 8:141379876-141379898 CACTGAGATGCCGGTTCGAGTGG + Intergenic
1049484902 8:142850710-142850732 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1049875737 8:145019169-145019191 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1050197841 9:3107040-3107062 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1050422133 9:5477181-5477203 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1050604093 9:7283070-7283092 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1051452712 9:17215404-17215426 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1051823180 9:21191961-21191983 CCCTGACATGGAGCTCCCTGCGG + Intergenic
1051825051 9:21210768-21210790 CCCTGGGATGGCGCTTCCAAAGG + Intronic
1052098125 9:24409242-24409264 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1052441139 9:28498010-28498032 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1053181204 9:35972011-35972033 CACTGCGAAGGTACTTCCTGGGG + Intergenic
1053847216 9:42251264-42251286 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1054374120 9:64436989-64437011 CACTGAGGAGGCGTTTACTGAGG - Intergenic
1055617150 9:78084361-78084383 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1056095694 9:83250861-83250883 CCCTGAGATGGAGCTCCCAGGGG + Intronic
1056095739 9:83251132-83251154 CCCTGGGATGGAGCTTCCAGTGG + Intronic
1056230209 9:84535795-84535817 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1056321002 9:85434193-85434215 CTCTGGGATGACGCTTCCAGAGG + Intergenic
1056953205 9:91062219-91062241 CTCTGTGCTGGAGCTTCCTGTGG - Intergenic
1057063485 9:92026545-92026567 CACGGGGACGGCCCTTCCTGGGG - Intergenic
1057698077 9:97341541-97341563 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1058517363 9:105790426-105790448 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1058943646 9:109836168-109836190 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1059713053 9:116887329-116887351 GACTGAGATGGAGATGCCTGGGG + Intronic
1059865106 9:118505296-118505318 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1061647549 9:132017660-132017682 CACGGAAATGGCTGTTCCTGTGG - Intronic
1062023756 9:134331071-134331093 CACTGAGGTAGCCCTTTCTGTGG + Intronic
1062213605 9:135377568-135377590 CCCTGAGATGAGGCGTCCTGTGG + Intergenic
1186563628 X:10638794-10638816 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1186593323 X:10953714-10953736 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
1187431330 X:19228022-19228044 CACTGCCATGGCCCTTCCCGAGG + Intergenic
1188123170 X:26334763-26334785 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1188271984 X:28152076-28152098 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1188723460 X:33551563-33551585 CCCTGAGATGGAGCTCCCAGAGG - Intergenic
1188869886 X:35360129-35360151 CCCTGAGATGGAGCTTCCAAGGG - Intergenic
1189534115 X:41919172-41919194 CACTAATAAGGAGCTTCCTGAGG - Intronic
1189861351 X:45275859-45275881 CCCTGGGATGGAGCTTCCAGAGG - Intergenic
1189896614 X:45663399-45663421 CTCTGACATGTGGCTTCCTGTGG - Intergenic
1190554912 X:51623906-51623928 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1190840874 X:54142877-54142899 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1191017735 X:55827864-55827886 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1191170643 X:57443965-57443987 CCCTGAGATGAAGCTTCCAGAGG - Intronic
1191172937 X:57467887-57467909 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1191204013 X:57815801-57815823 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1191656891 X:63607805-63607827 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1191782072 X:64879465-64879487 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1191809439 X:65171394-65171416 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1192067813 X:67904540-67904562 CACTGAGAAGGAGCTTCCAGAGG - Intergenic
1192097276 X:68225510-68225532 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1192287622 X:69755416-69755438 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1192897625 X:75460286-75460308 CCCTGGGATGGAGCTTCCAGGGG + Intronic
1192923612 X:75733898-75733920 CACTGGGATGGAGCTCCCAGAGG - Intergenic
1193019883 X:76780450-76780472 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1193267875 X:79494598-79494620 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1193336789 X:80299138-80299160 CACTGAAATTGCTCTTCCTAAGG + Intergenic
1193449623 X:81649706-81649728 CATAGGGATGGGGCTTCCTGAGG + Intergenic
1193661792 X:84267247-84267269 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1193733783 X:85133018-85133040 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1194158615 X:90423201-90423223 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1194281297 X:91957636-91957658 CCCTGGGATGGAGCTTCCAGAGG - Intronic
1194636481 X:96350716-96350738 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1194947906 X:100091108-100091130 CCCTGAGATGGAGCTCCCAGGGG + Intergenic
1194954328 X:100161960-100161982 CTCTGGGATGACGCTTCCAGAGG - Intergenic
1195440652 X:104895138-104895160 CTCTGAGATGAAGCTTCCAGAGG - Intronic
1195826839 X:109011156-109011178 CTCTGAGATGACGCTTCCAGAGG + Intergenic
1195856140 X:109335173-109335195 CCCTGAGATGAAGCTTCCAGAGG - Intergenic
1196352617 X:114749612-114749634 CACTTAGATGTCACTTCCTCTGG - Intronic
1196528767 X:116759108-116759130 CTCTGAGATGGAGCTCCCAGAGG + Intergenic
1196944729 X:120812292-120812314 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1197098255 X:122621211-122621233 CTCTGGGATGAAGCTTCCTGTGG - Intergenic
1197114794 X:122818906-122818928 CCCTGGGATGGAGCTTCCAGAGG + Intergenic
1198061983 X:133055312-133055334 CACAGAGATGGCCCTTGCAGTGG + Intronic
1198123833 X:133621940-133621962 CTCTGAGATGAAGCTTCCAGAGG + Intronic
1198166389 X:134062005-134062027 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1198366037 X:135941119-135941141 CTCTGAGATGAAGCTTCCAGGGG - Intergenic
1199486305 X:148352251-148352273 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1200504931 Y:4000169-4000191 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1200598886 Y:5182292-5182314 CCCTGGGATGGAGCTTCCAGAGG - Intronic
1201620008 Y:15946310-15946332 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1201690849 Y:16762829-16762851 CTCTGAGATGAAGCTTCCAGAGG + Intergenic
1201920845 Y:19232169-19232191 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1201957751 Y:19645085-19645107 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1202020735 Y:20462614-20462636 CTCTGAGATGAAGCTTCCAGAGG - Intergenic
1202034671 Y:20620191-20620213 CTCTGAGATGAAGCTTCCAGAGG - Intergenic