ID: 1154356074

View in Genome Browser
Species Human (GRCh38)
Location 18:13624131-13624153
Sequence CGGTGCTGAGGCGGAGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154356067_1154356074 10 Left 1154356067 18:13624098-13624120 CCCGCAACAAAGACTCATCTGAG 0: 1
1: 0
2: 7
3: 31
4: 290
Right 1154356074 18:13624131-13624153 CGGTGCTGAGGCGGAGGAGCCGG 0: 1
1: 0
2: 2
3: 34
4: 381
1154356066_1154356074 29 Left 1154356066 18:13624079-13624101 CCTACAGTGCACAGGCAGTCCCG 0: 1
1: 0
2: 2
3: 39
4: 289
Right 1154356074 18:13624131-13624153 CGGTGCTGAGGCGGAGGAGCCGG 0: 1
1: 0
2: 2
3: 34
4: 381
1154356068_1154356074 9 Left 1154356068 18:13624099-13624121 CCGCAACAAAGACTCATCTGAGT 0: 1
1: 1
2: 1
3: 30
4: 272
Right 1154356074 18:13624131-13624153 CGGTGCTGAGGCGGAGGAGCCGG 0: 1
1: 0
2: 2
3: 34
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154356074 Original CRISPR CGGTGCTGAGGCGGAGGAGC CGG Intronic
900038795 1:439831-439853 CCGCGCTGGGTCGGAGGAGCAGG + Intergenic
900060229 1:674810-674832 CCGCGCTGGGTCGGAGGAGCAGG + Intergenic
900376441 1:2356977-2356999 CCGTGCAGAAGCGGAGCAGCGGG + Intronic
900390212 1:2430551-2430573 GGGTCCTCAGGCGGAAGAGCTGG - Intronic
900401773 1:2475688-2475710 CCGAGCTGTGGCGGAGGAGGTGG - Intronic
900512673 1:3068013-3068035 AGGCGCTGCGGCGGAGGGGCCGG - Intergenic
900661560 1:3787028-3787050 AGGTGGTGATGGGGAGGAGCAGG - Exonic
901236239 1:7669131-7669153 AGCTACTGAGGCGCAGGAGCAGG + Intronic
901304826 1:8225260-8225282 CGGTGATGACGAGGAGGAGGAGG - Intergenic
901700627 1:11043288-11043310 CTGGGCTGAGGGGGAGGATCTGG + Intronic
901746201 1:11375393-11375415 GGGAGCTGAGCCTGAGGAGCTGG + Intergenic
903220118 1:21864808-21864830 CTGTGCAGAGGTGGTGGAGCTGG + Intronic
904045284 1:27604645-27604667 GGCTGCTGGGGCGGGGGAGCGGG + Intergenic
904454024 1:30636206-30636228 AGGTGCTGAGGCTGTGGAGGTGG + Intergenic
904501441 1:30915078-30915100 CTGTGCAGAGGTGGAGAAGCTGG + Intergenic
904762743 1:32817493-32817515 CGGGGCTGAGGCGCCTGAGCGGG + Exonic
904772006 1:32886041-32886063 GGGAGTTGAGGCGCAGGAGCAGG + Intronic
906686423 1:47766088-47766110 GGGTGGTGAGGCGGTGGTGCTGG + Exonic
907051032 1:51330235-51330257 CTGTGAGGAGGCGGAGGCGCGGG - Intronic
907451460 1:54548188-54548210 GGGAGCTGGGGAGGAGGAGCAGG + Intronic
910272508 1:85411859-85411881 CAGTGCTGAGGCTGAGGTGTCGG - Intronic
911176260 1:94820649-94820671 CAGTGCTGGGGCGGAGGCGGGGG + Intronic
912023488 1:105137991-105138013 TGATGCTGAGGAGGAGGAGGAGG - Intergenic
912699219 1:111864051-111864073 GGGAGCAGAGGAGGAGGAGCAGG + Intronic
912927899 1:113929703-113929725 CGGGGCTGAGGCGGCGGCGGCGG + Exonic
913988047 1:143583789-143583811 CGGTGCTGTGGCTGCGGAGATGG - Intergenic
915510726 1:156385643-156385665 CTGTCCTGAGTCTGAGGAGCGGG + Intergenic
916025154 1:160827245-160827267 CTGTGCTGACCCAGAGGAGCGGG - Intronic
917569178 1:176246593-176246615 CTGTGCTTAGGAGGAGGAACAGG + Intergenic
919768150 1:201140532-201140554 CGGGGCTGAGGCTGAGGGGGAGG + Intronic
919977717 1:202623492-202623514 CTGTCCTGGGGCGGAGGAGAGGG + Intronic
920702593 1:208229063-208229085 CGGGGCTGAGCCTAAGGAGCTGG - Intronic
920839500 1:209542213-209542235 CGGTGCTGAAGAGAAGGATCTGG + Intergenic
921923108 1:220690322-220690344 CCGGGCTGGGGCGGAGGAGCGGG + Exonic
922907544 1:229185834-229185856 ACGTGCTGGGACGGAGGAGCAGG + Intergenic
924741887 1:246799030-246799052 AGCTGCAGAGGCCGAGGAGCAGG + Intergenic
924927296 1:248695693-248695715 CAGTGCTGAGGCCTGGGAGCTGG - Intergenic
1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1063663653 10:8049719-8049741 AGGGGCCGAGGCGGAGGAGGGGG + Intergenic
1065099779 10:22321435-22321457 CGAGGCGGAGGCGGAGGAGGAGG + Exonic
1066279244 10:33898963-33898985 GGGTGCTGCAGCTGAGGAGCTGG - Intergenic
1067819960 10:49519878-49519900 AGGTGCAGAGTGGGAGGAGCTGG - Intronic
1068030451 10:51698825-51698847 AAATGCTGAGGCTGAGGAGCTGG + Exonic
1068620508 10:59176703-59176725 CGGCGCCGAGGCTGAGGCGCGGG - Exonic
1069544492 10:69318813-69318835 CCGGGCCGAGGGGGAGGAGCCGG + Intronic
1070079147 10:73168302-73168324 CGCGGCTGAGGAGGAGGAGGAGG + Exonic
1070131089 10:73655898-73655920 GGGTGCTGAGGAGGAGGTGCTGG - Exonic
1070257619 10:74825490-74825512 CGGAGCCGAGGAGGAGGAGGCGG + Intergenic
1070290733 10:75111729-75111751 GGGAGCTGAGGCTGAGGAGAGGG + Intronic
1070458718 10:76643614-76643636 CTGTGCTGAGGCGCCGGGGCAGG - Intergenic
1070654288 10:78260720-78260742 AGCTGCTGAGGAGGAGGAGGAGG - Intergenic
1070993154 10:80750774-80750796 CTGTGCTGAGGCAAGGGAGCTGG - Intergenic
1071527508 10:86366814-86366836 CGGAGCTGAGGGGGAGGGGGAGG - Intergenic
1072563252 10:96596335-96596357 CAGTGAGGAGGCAGAGGAGCAGG - Intronic
1072660457 10:97360567-97360589 AGAGGCTGAGGAGGAGGAGCTGG - Exonic
1073340922 10:102744019-102744041 CGGCGCCGTGGCGGAGGAGCAGG + Exonic
1073526219 10:104184694-104184716 GGGTTCTGAGGCATAGGAGCTGG - Intronic
1075676715 10:124300902-124300924 GGGTGCTGCGGCTGAGGAGTTGG - Intergenic
1076374189 10:129972701-129972723 CGGGGCTGCGGCGGAGGCGCGGG - Intergenic
1076511693 10:131018797-131018819 CGGGGCTGATGAAGAGGAGCTGG - Intergenic
1076542067 10:131220738-131220760 CTTTGCAGGGGCGGAGGAGCTGG - Intronic
1076770075 10:132657952-132657974 AGGTGCTGGGGCCGGGGAGCAGG - Intronic
1076864720 10:133160963-133160985 CGGAGCTGAGGTTCAGGAGCGGG + Intronic
1077074662 11:694927-694949 AGGAGGCGAGGCGGAGGAGCCGG - Exonic
1077306420 11:1870578-1870600 CGGTGCTGTGGGAGTGGAGCAGG + Intronic
1077886277 11:6390364-6390386 CGCTGCGGAGGCGGAGGGGGCGG - Intergenic
1080802010 11:35618332-35618354 GGGAGCGGAGGCGGAGGAGGGGG + Intergenic
1080846990 11:36035340-36035362 CAGTGCTGTGGCGGTGGAGGTGG - Intronic
1083255876 11:61495216-61495238 GGGTGCTGAGGCGGAGGGCGTGG - Intergenic
1083323642 11:61862581-61862603 AGGTGCTGAGGAGGAGGGACAGG + Intronic
1083571972 11:63765867-63765889 GGGGGCTGAGGAGGAGGAGGAGG - Exonic
1084437952 11:69155110-69155132 AGGGCCTGAGGCGCAGGAGCTGG + Intergenic
1085184824 11:74566651-74566673 AGCTGGTGAGGCAGAGGAGCAGG - Intronic
1085643360 11:78207370-78207392 AGGGGCTGGGGAGGAGGAGCAGG - Intronic
1086167070 11:83791241-83791263 CGGTGCTGAGGAGGAGGAGAAGG + Intronic
1088840639 11:113624738-113624760 TGGGGCTGAGGAGGAGAAGCAGG - Intergenic
1090625450 11:128604328-128604350 TGGGGCAGAGGCGAAGGAGCTGG - Intergenic
1091671704 12:2456751-2456773 GAGTGCTGAGGAGGAGGAGCGGG - Intronic
1092112132 12:5971309-5971331 AGGTGCTGTGGCTGAGGGGCTGG - Intronic
1093086217 12:14869072-14869094 GGGTGCCCAGGGGGAGGAGCAGG - Intronic
1093464918 12:19439661-19439683 CGGTGGGGAGGAGGAGGAGGAGG + Exonic
1094487014 12:30933485-30933507 CAGTGCTGAGAGGAAGGAGCTGG - Intronic
1096242148 12:49965275-49965297 CTTGGCTGAGGAGGAGGAGCTGG + Exonic
1097938386 12:65278507-65278529 CGGTGCAGAGGAGGAGGAGGAGG + Intergenic
1097959928 12:65522390-65522412 CGGTGCTGGGCTGGAAGAGCTGG + Intergenic
1100315544 12:93441680-93441702 GGGTGCTGAGGAGGGGGCGCCGG - Intronic
1100982553 12:100172949-100172971 GGCTGCTGAGGGGGAGGGGCTGG + Intergenic
1101578881 12:106023649-106023671 AAGTGCTTAGGCAGAGGAGCAGG + Intergenic
1102238721 12:111310420-111310442 CGGGGCAGAGGAGGAGCAGCTGG + Exonic
1102520100 12:113472507-113472529 GGGTGGGGAGGCGGGGGAGCAGG + Intergenic
1102646240 12:114405685-114405707 CGGCGGTGAGGCGGGGGAGCAGG + Intronic
1103325384 12:120116790-120116812 GGCTGCTGAGGAGGAGGAGGGGG - Exonic
1104841832 12:131829266-131829288 CAGTGCTGAGCCGGGGGCGCGGG + Intronic
1105378184 13:19863638-19863660 TGGTGAGGAGGCGGAGAAGCAGG + Intergenic
1105389054 13:19958720-19958742 CGCTGGTGAGGAGGAGGAGGCGG - Exonic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1105578629 13:21674460-21674482 CGGAGCGGAGGCGGGGGCGCGGG - Intronic
1105817724 13:24051895-24051917 CGGGGCTGAGGAGGAGGAACAGG - Intronic
1108561226 13:51646193-51646215 CGATGCTGAGGATGAGGAGCTGG - Intronic
1110190859 13:72727566-72727588 CGGTGCTGGGGCGGCGGCGGCGG - Exonic
1111934941 13:94548959-94548981 CGGTGCTGATGCTGCGGATCTGG + Intergenic
1112002315 13:95222285-95222307 CAGTTCTGAGGCAGAGGAGTGGG - Intronic
1113030600 13:105990013-105990035 CGGTGGTGGTGCCGAGGAGCTGG - Intergenic
1113492436 13:110703074-110703096 TGGTGCTAGGGGGGAGGAGCAGG - Intronic
1113523555 13:110956746-110956768 CAGGGCTGAGGCGGTGGAGGAGG + Intergenic
1113701711 13:112393489-112393511 CAGGGCTGAGGCGGTGGAGGAGG - Intronic
1114888180 14:26881133-26881155 AGGTGCTGAGACTGAGGTGCAGG - Intergenic
1115566642 14:34630197-34630219 CGGGGCGGAGGCGAAGGGGCGGG + Intergenic
1117189770 14:53278383-53278405 TGATGCTGAGGAGGAGGAGGAGG - Intergenic
1118992439 14:70809069-70809091 CGGGGCCGAGGAGGAGGAGGAGG - Exonic
1119418630 14:74493229-74493251 CGGTGCTGAGCGCCAGGAGCAGG + Exonic
1121044143 14:90775609-90775631 CTGTGCCCAGGTGGAGGAGCTGG - Intronic
1122658472 14:103278998-103279020 CGGAGCCGGGGCGGAGGAGGCGG - Intergenic
1122783442 14:104153410-104153432 CTGTGGTGAGGCCGAGGAGAGGG + Intronic
1122905812 14:104800961-104800983 CGGGACTCAGGCGCAGGAGCCGG - Exonic
1122919231 14:104873258-104873280 CTGTGCTGAGTCAAAGGAGCCGG + Intronic
1123571415 15:21614326-21614348 GGGTGCTGTGGCTGAGGAACAGG - Intergenic
1124493365 15:30171856-30171878 CTGTCCTGGGGCGGAGGAGAGGG + Intergenic
1124750169 15:32366469-32366491 CTGTCCTGGGGCGGAGGAGAGGG - Intergenic
1125292861 15:38168832-38168854 CAGTGCTGAGCAGGAGGAGGTGG + Intergenic
1125838700 15:42777715-42777737 AGGAGCTGAGGCAGAGGAGAAGG + Intronic
1125927756 15:43577144-43577166 CCGTGTTCAGGCTGAGGAGCTGG - Exonic
1125940899 15:43676709-43676731 CCGTGTTCAGGCTGAGGAGCTGG - Intergenic
1129328247 15:74813191-74813213 GGGTGTTGAGGCGGTGGAGCAGG - Intronic
1129386793 15:75200874-75200896 TGGAGCTGAGGAGGAGGGGCTGG - Intronic
1129655932 15:77525805-77525827 GGGTGCTGAGTCGGGGGAGGTGG + Intergenic
1129825706 15:78633873-78633895 CAGTGCTGGGGCAGGGGAGCAGG + Intronic
1131158580 15:90090090-90090112 CAGGGCTGAGGAGGAGGAGGAGG - Intronic
1131282328 15:91032092-91032114 CAGTGCCGAGGAGGAGCAGCAGG - Intergenic
1131870291 15:96756882-96756904 CGAGGCTGAGGAGGAGGAGGAGG + Intergenic
1132017967 15:98335825-98335847 GGGTGCTGCGGCCGAGGAGATGG - Intergenic
1132040575 15:98521923-98521945 CGGGGGTGAGGAGGAGGAGGAGG - Intergenic
1132443119 15:101887774-101887796 CCGCGCTGGGTCGGAGGAGCAGG - Intergenic
1132583170 16:694496-694518 CGGGTCCGAGGCGGAGGAGGAGG - Intronic
1132591525 16:728298-728320 CCGAACTGCGGCGGAGGAGCAGG - Exonic
1132871259 16:2116737-2116759 CTGGGCTGAGGAGGAGGGGCTGG - Intronic
1132892453 16:2210929-2210951 CAGAGCTGAGGGGGAGGCGCAGG - Exonic
1133172870 16:3992634-3992656 CGGTGCGGAGGTGGAGGGGAAGG + Intronic
1133237756 16:4395492-4395514 CTGTGCTGAGGAGGAGGAACAGG - Intronic
1134061920 16:11204575-11204597 TGATGCTGAGGAGGAAGAGCAGG + Intergenic
1134521267 16:14920157-14920179 CTGGGCTGAGGAGGAGGGGCTGG + Intronic
1134708942 16:16318808-16318830 CTGGGCTGAGGAGGAGGGGCTGG + Intergenic
1134716152 16:16358842-16358864 CTGGGCTGAGGAGGAGGGGCTGG + Intergenic
1134950663 16:18349837-18349859 CTGGGCTGAGGAGGAGGGGCTGG - Intergenic
1134958601 16:18393317-18393339 CTGGGCTGAGGAGGAGGGGCTGG - Intergenic
1137072217 16:35913623-35913645 CCATGCTGAGAAGGAGGAGCAGG - Intergenic
1137926630 16:52547092-52547114 CGGGGAGGAGGAGGAGGAGCGGG - Intronic
1140457039 16:75111683-75111705 CAGCTCTGAGGCGGAGTAGCTGG + Intergenic
1140703227 16:77601895-77601917 CGGTGCCCAGGCAGAGGTGCCGG - Intergenic
1141430720 16:83969061-83969083 CGGTGGAGGGGCGGAGGAGGGGG - Intronic
1141631552 16:85290822-85290844 AGCTGGTGAGGCTGAGGAGCAGG - Intergenic
1141695311 16:85616281-85616303 CCGAGCTGAGGGGCAGGAGCTGG + Intronic
1142157310 16:88538460-88538482 CTGTGCTGAGGCAGAGAAGGGGG - Intergenic
1142613169 17:1120206-1120228 CTGTGATGAGGGGGAGGAGGAGG + Intronic
1142638223 17:1270698-1270720 CCGGGGCGAGGCGGAGGAGCCGG + Exonic
1142871181 17:2822011-2822033 TGGTGCTGAGGAGGAGGAGGCGG + Intronic
1143099872 17:4499083-4499105 CGGCGCGGAGGAGGAGGAGGCGG + Exonic
1143949042 17:10618464-10618486 CGGAGCTGAGGTGGGGCAGCAGG + Intergenic
1144339741 17:14301673-14301695 CGGCGCGGCGGCGCAGGAGCCGG - Exonic
1144862589 17:18314945-18314967 CGGTGCTGAGGCGGCGGCTGCGG - Exonic
1146295570 17:31647486-31647508 AGGTGCTGCGGCAGAGGAGATGG - Intergenic
1147212846 17:38882084-38882106 CGGTGCTGGGGCGGGGGAGGAGG + Intronic
1147319471 17:39637161-39637183 CGCTACTGAGGCCGCGGAGCCGG + Exonic
1148156975 17:45430153-45430175 CGGTGCTGCGCCGCAGCAGCCGG + Intronic
1148194603 17:45704323-45704345 AGGTGGTGAGGCTGTGGAGCAGG - Intergenic
1148495052 17:48048539-48048561 TGGTGCTGAGGTGCAGGAGGCGG + Intronic
1149560511 17:57604889-57604911 CAGGGCTGAGGAGGAGCAGCTGG - Intronic
1151961360 17:77407663-77407685 AGGCCCTGGGGCGGAGGAGCAGG - Intronic
1152561548 17:81081320-81081342 CTGTGCTGAGGAGCAGGATCAGG - Intronic
1152688661 17:81707586-81707608 CGGTGCTCAGGCCGAGCTGCGGG + Intergenic
1154356074 18:13624131-13624153 CGGTGCTGAGGCGGAGGAGCCGG + Intronic
1157493584 18:48139899-48139921 GGGAGCTGAGGAGGAGGAGGAGG - Intronic
1159590100 18:70324976-70324998 GGGTGCTGAGGAGGAGGAGAAGG - Exonic
1160186250 18:76678835-76678857 CTGGGCTGAGGATGAGGAGCAGG - Intergenic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160744386 19:703924-703946 CGGGGCTGAGGTGCAGGGGCGGG + Intergenic
1160835705 19:1123582-1123604 CGAGGCTGAGGAGGAGGAGGCGG - Exonic
1161306298 19:3570708-3570730 CGGGGCTGAGGAAGAGGAGCTGG - Intronic
1161354474 19:3811176-3811198 CGGGGCTGAGGCGGCCGCGCCGG + Intronic
1161513211 19:4683100-4683122 CGGCGATGAGGAGGAGGAGGAGG - Intronic
1161729502 19:5950581-5950603 TGGTGCTCAGGCGGTAGAGCTGG + Intronic
1162378877 19:10320711-10320733 CGCTGCTGAGGGGGCTGAGCAGG + Exonic
1162722746 19:12672280-12672302 GAGTACTGAGGAGGAGGAGCTGG + Intronic
1162988766 19:14288963-14288985 CGGTTCTGAGCGGGAGGAGGGGG + Intergenic
1163029815 19:14536979-14537001 CGGGGCCGAGGAGGAGGAGGTGG + Intronic
1163029855 19:14537104-14537126 CAGGGCTGAGGTGGAGGAGGTGG + Intronic
1163105873 19:15122844-15122866 CAGTGCTGGGGCCGAGGGGCTGG - Intronic
1164594518 19:29524950-29524972 CAGAGCTGAGGCGTAGGGGCCGG + Intergenic
1165076513 19:33282566-33282588 CAGTGCTGAGGCCCAGCAGCAGG - Intergenic
1166239316 19:41478975-41478997 GGGGGCTGAGGATGAGGAGCTGG - Intergenic
1166703655 19:44896438-44896460 CAGTGCTGAGGCCGAGAAGTCGG - Intronic
1167649931 19:50723627-50723649 AGGTGCCCAGGAGGAGGAGCGGG + Exonic
1168153591 19:54461506-54461528 CGGTGTGGCGGCGGAGGATCTGG - Exonic
1168309767 19:55454568-55454590 AGGGGCAGAGGCGGAGGAGATGG + Intronic
1168685674 19:58347725-58347747 CGGGGCTGAGGCGCAGGCGCGGG - Intronic
927129783 2:20049058-20049080 CAGTGATGAGGAGGAGGAGAAGG - Intronic
927628478 2:24749271-24749293 CTGAGCTGAGGAGGTGGAGCTGG + Intronic
928143577 2:28751841-28751863 CGGTGCCGAGGAGGAGGAGGTGG + Exonic
928490530 2:31778397-31778419 CGGTGGTGTGGCGGGGGTGCTGG - Intergenic
929511447 2:42568672-42568694 CGCGGCTGAGGCTGAGGAGGAGG + Intronic
929620342 2:43348244-43348266 CGGAGCTGAGCAGCAGGAGCTGG + Intronic
929701824 2:44169028-44169050 CGAGGCTGCGGCGGAGGAGGTGG + Exonic
930095163 2:47561142-47561164 CAGTGCTTAGGCTGAGGAGGAGG - Intronic
931198491 2:60075058-60075080 CGGTGCAGAGGGGGCAGAGCTGG - Intergenic
934657310 2:96123016-96123038 CGGAGCTGGGGCAGAGGAGTAGG + Intergenic
936076262 2:109403670-109403692 GGGTGCTGGGGTGGAGGTGCAGG + Intronic
936098061 2:109549193-109549215 CGGTGATGTGGGAGAGGAGCAGG + Intronic
936502519 2:113077546-113077568 CTGTCCTGAGGAGGAGGAGGAGG - Intergenic
937950876 2:127387511-127387533 CCGCGCTGGGGCGGAGGGGCGGG - Intronic
937969107 2:127536032-127536054 GGGGGCTGAGGAGGAGGAGGAGG + Intronic
938875946 2:135531608-135531630 CGTTACTGAGGAGGAGGAGGCGG - Intronic
939969641 2:148644885-148644907 CAGTGAGGAGGAGGAGGAGCGGG + Intronic
942613264 2:177763560-177763582 CTGCCCTGAGGGGGAGGAGCTGG + Intronic
943313049 2:186351748-186351770 CTGTACTGAGGCAAAGGAGCGGG - Intergenic
945251700 2:207769957-207769979 CGGGCCTGAGGGGGCGGAGCCGG - Intergenic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
948046840 2:234951901-234951923 CGGAGCTGAGGCCGCGGAGGGGG - Intergenic
948793359 2:240390416-240390438 CAGTGCTGAGGCCGTGGAGCTGG - Intergenic
948818307 2:240525207-240525229 GGGTGCTGCAGCTGAGGAGCTGG - Intronic
1169194224 20:3674697-3674719 GGGTGCAGAGGGGTAGGAGCGGG + Intronic
1169554558 20:6735727-6735749 CACTGATGAGGAGGAGGAGCAGG + Intergenic
1170756784 20:19212441-19212463 GGGGGCAGAGGAGGAGGAGCGGG - Intergenic
1172149415 20:32779799-32779821 CGGTTCTGTGGGGGAGGAGGGGG + Intronic
1172295934 20:33811327-33811349 CGGGGCGGAGGCGGAGGCGGAGG + Exonic
1172633875 20:36396192-36396214 CGGTGCTGAGGGGCAGATGCTGG - Intronic
1172774181 20:37397712-37397734 CGGTGGTGAGGCGGTGGCACAGG - Exonic
1172896617 20:38304704-38304726 CGTTGCTGAGGAGGCTGAGCAGG + Intronic
1172937331 20:38629583-38629605 CGGTGCTCCTGCAGAGGAGCAGG + Exonic
1174374415 20:50116102-50116124 CGGTGATCAGGCGCAGGCGCCGG - Intronic
1174767732 20:53269580-53269602 TGGTGATGAGGAGGAGGAGGAGG + Intronic
1175305606 20:57973725-57973747 CACTGCTGGGGAGGAGGAGCTGG - Intergenic
1175852890 20:62103525-62103547 CGGTGCTAATGCTGGGGAGCGGG - Intergenic
1176089150 20:63311390-63311412 CGGGGCGGAGGCAGAGGTGCTGG - Exonic
1176161853 20:63652515-63652537 CGGAGCTCAGGCGGAGGGGCGGG - Intronic
1176308442 21:5136535-5136557 CTGTGCTGAGGGGGAAGGGCAGG + Intronic
1176387855 21:6148160-6148182 CGGTGCAGAGATGGACGAGCTGG - Intergenic
1176663477 21:9662188-9662210 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1178354539 21:31899687-31899709 TGGTGCTGAGCAGGAGTAGCAGG - Intronic
1178544243 21:33479916-33479938 CGGGGCTGAGGTGGAGCCGCGGG - Exonic
1179454665 21:41490840-41490862 AGGTGCAGAGGTGGAGGAGAGGG + Intronic
1179633402 21:42692416-42692438 CGGTGCTGAGGCGGAGCACCTGG + Intronic
1179735617 21:43390088-43390110 CGGTGCAGAGATGGACGAGCTGG + Intergenic
1179848618 21:44125497-44125519 CTGTGCTGAGGGGGAAGGGCAGG - Intronic
1180823424 22:18847329-18847351 CGGGGCTAAAGCGGAGGAGGGGG + Exonic
1181123848 22:20690428-20690450 CGGGGCTAAAGCGGAGGAGGGGG + Intergenic
1181189318 22:21127217-21127239 CGGGGCTAAAGCGGAGGAGGGGG - Exonic
1181209880 22:21283278-21283300 CGGGGCTAAAGCGGAGGAGGGGG + Intergenic
1181399635 22:22643666-22643688 CGGGGCTAAAGCGGAGGAGGGGG - Intergenic
1181516315 22:23415588-23415610 CTGGGCTGGGGCGGAGGGGCTGG - Intergenic
1181649781 22:24252402-24252424 CGGGGCTAAAGCGGAGGAGGGGG + Intergenic
1181707593 22:24658344-24658366 CGGGGCTAAAGCGGAGGAGGGGG - Intergenic
1181892513 22:26076059-26076081 GGGTGGTGAGTCTGAGGAGCTGG - Intergenic
1182134894 22:27892219-27892241 CTGTGCTGAGGTGGAGGTGATGG + Intronic
1183332794 22:37230272-37230294 CGGGGCTGGGGCGGTGGGGCGGG + Intronic
1183411044 22:37655326-37655348 CGGGGCTGGAGGGGAGGAGCGGG - Exonic
1184681552 22:46074852-46074874 GGGTGCTGATGGGGACGAGCTGG + Intronic
1184948155 22:47818764-47818786 GGCTGCAGAGGCAGAGGAGCTGG + Intergenic
1185370822 22:50460145-50460167 CTGTGCAGTGTCGGAGGAGCTGG - Exonic
1203217066 22_KI270731v1_random:12155-12177 CGGGGCTAAAGCGGAGGAGGGGG - Intergenic
1203273565 22_KI270734v1_random:73235-73257 CGGGGCTAAAGCGGAGGAGGGGG + Intergenic
951558698 3:23945503-23945525 CGGCGCTGAGGCGGCGGCGGCGG + Exonic
952414289 3:33076325-33076347 AGCTGCTGAGGCAGAGGAGGAGG + Intronic
953391429 3:42536097-42536119 CGGAGCTGAGGCGGAAGTGGCGG + Exonic
954462755 3:50637082-50637104 CTTTGCTGAGGTAGAGGAGCAGG - Intronic
954632950 3:52056725-52056747 CGGTGCGGAGGCGGTGGGGGAGG - Intergenic
954841840 3:53518133-53518155 GGGTGCTGAAGCTGGGGAGCTGG + Intronic
955326232 3:58010902-58010924 CGGTGGTGGGGAGGGGGAGCAGG - Intronic
955407419 3:58634186-58634208 AGGGGCTGAGGAGGAGGAGCAGG - Exonic
956325654 3:68049774-68049796 AGGTGGTGAGGGGAAGGAGCAGG + Intronic
959155755 3:102664347-102664369 CGGTGAGCAGGTGGAGGAGCCGG - Intergenic
960118202 3:113919137-113919159 GGGTGCTGAGCAGAAGGAGCTGG + Intronic
960466312 3:118000105-118000127 GGGTGCTGAGGCTGAGAAACTGG - Intergenic
960615281 3:119590852-119590874 CAGTGGTGAGGGGGAGGAGGGGG - Intergenic
961006708 3:123410351-123410373 CTGTGTTGAGGAGGAGGAGGAGG - Intronic
961121940 3:124380208-124380230 CTGGGCTGAGGCGGAGAAGCAGG - Intronic
961858247 3:129893662-129893684 CGGGGCTGAGGCGGCGGCGGCGG - Intergenic
961871522 3:129992000-129992022 CAGTGCTGTGAAGGAGGAGCTGG - Intergenic
963416138 3:144998431-144998453 CGGGGCTGAGGCGGAGATGAAGG - Intergenic
964880521 3:161418103-161418125 CAGTGATGAGGCAGAGGAGCTGG + Intergenic
966711944 3:182980513-182980535 CGCTGCGGAGCCGGAGGAGGAGG - Exonic
968456877 4:704747-704769 CGGGGGTGAGGCGGACGTGCAGG - Intergenic
968592316 4:1465302-1465324 CGGTGCTGGGGAGGAGACGCCGG + Intergenic
968592411 4:1465673-1465695 GGGTGCTGAGGAGGAGGAGGCGG + Intergenic
968902696 4:3438910-3438932 CGGTGCTGAGGCAGCGAGGCAGG + Intronic
968954837 4:3712974-3712996 CGGGGCAGAGGGGGAGGAGTGGG - Intergenic
969184204 4:5463416-5463438 AGGGGCTGAGGAGGAGCAGCAGG - Intronic
969362665 4:6674443-6674465 GCGTGCGGAGGCTGAGGAGCGGG + Intergenic
969467499 4:7366393-7366415 CTGTGCTGAGCCAGGGGAGCAGG - Intronic
969482080 4:7452027-7452049 CTGTGCAGAGCAGGAGGAGCCGG - Intronic
969682017 4:8648509-8648531 CTGAGCTGAGGAGGAGCAGCAGG + Intergenic
973532153 4:51844320-51844342 CGGGGCTGAGGTGGAGGAGACGG + Intronic
974479942 4:62430206-62430228 GGGTGCCCTGGCGGAGGAGCAGG + Intergenic
976146131 4:82044195-82044217 CGCGGCTGCGGCGGAGGGGCTGG + Intronic
977315786 4:95445844-95445866 CAGTGCTGGAGCGGAGGAGAGGG + Intronic
979539969 4:121870158-121870180 TGGTGCGGAGGCGAAGGAGCCGG - Intronic
983140168 4:164140626-164140648 GGGTGCTGTAGCCGAGGAGCTGG - Intronic
984127771 4:175833343-175833365 AGGTGGTAAGGAGGAGGAGCTGG - Intronic
984762693 4:183376656-183376678 CAGTGGGGAGGGGGAGGAGCGGG - Intergenic
985002780 4:185502461-185502483 CGGTGCTGTGGTGAAGGCGCGGG - Exonic
985301069 4:188490280-188490302 CGGTGCTGCAGCAGAGGAGGTGG + Intergenic
985695597 5:1338388-1338410 CGGAGCTGTGGCGCAGGAGTTGG + Intronic
985818646 5:2145299-2145321 CGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818726 5:2145741-2145763 CGGTGAGGAGGTGGAGGATCCGG - Intergenic
985818862 5:2146507-2146529 CGGTGAGGAGGTGGAGGATCTGG - Intergenic
986430124 5:7673507-7673529 CAGTGCTGAGGTGCAGAAGCTGG - Intronic
989576494 5:42992795-42992817 CTGTGCTGTGGCGGCGGGGCTGG + Intergenic
991994442 5:72373630-72373652 CATTGCGGAGGGGGAGGAGCTGG - Intergenic
996691065 5:126340597-126340619 CAGTGCTGAAGCCCAGGAGCCGG + Intergenic
997028341 5:130092739-130092761 AGGTGCTGTGGCAGAGGAGATGG + Intronic
999773091 5:154790246-154790268 CGGTGATGAGGGTGAGGAGCTGG + Intronic
1001251746 5:170152272-170152294 TAGTGCTGAGGCTGAGAAGCCGG + Intergenic
1001647162 5:173290501-173290523 TGGTGCTGAGCAGGAGGAACTGG - Intergenic
1001925448 5:175632938-175632960 TGGTGCTGAGTAGGATGAGCTGG - Intergenic
1002342705 5:178527293-178527315 CTGTGCTGGGGTGAAGGAGCCGG + Intronic
1002416180 5:179122013-179122035 GGGTGCAGGGGCAGAGGAGCCGG - Intronic
1002735052 5:181379112-181379134 CCGCGCTGGGTCGGAGGAGCAGG - Intergenic
1002784605 6:391969-391991 CTGCGCTGAGCCGGAGGCGCTGG + Intronic
1004244968 6:13965781-13965803 GGGTGCTGGGGCTGAGGAGATGG + Intronic
1004650200 6:17600658-17600680 CGGTGCAGAGCTGCAGGAGCAGG + Exonic
1004806731 6:19211010-19211032 CGGTGGTGAGGTGGAGCTGCTGG + Intergenic
1005161724 6:22871660-22871682 CGGTGGTGGGGAGGAGGAGATGG + Intergenic
1005825181 6:29628020-29628042 CGGAGGGGAGGAGGAGGAGCAGG + Intronic
1007619458 6:43203224-43203246 CAGGGCTGAGGAGGAGGAGGTGG + Intronic
1011272469 6:85593598-85593620 CGGCGCTGAGACAGAGCAGCAGG + Exonic
1011607337 6:89117995-89118017 CGGGGCTGAGGCCGAGGGGTGGG - Exonic
1015016416 6:128418709-128418731 TGGTGCTGAGGAGGAGGCTCAGG - Intronic
1017520311 6:155195990-155196012 CGTTGCAGAGAAGGAGGAGCAGG + Intronic
1017716789 6:157218595-157218617 CGATCCTGAGGCGTGGGAGCTGG + Intergenic
1017877462 6:158536606-158536628 CGGGACCGAGGAGGAGGAGCAGG - Exonic
1019073953 6:169371698-169371720 CGATGCTCAGGCTGAAGAGCTGG + Intergenic
1019094405 6:169567164-169567186 CGGTGCTGCTGGGGAGGACCCGG + Intronic
1019112018 6:169724253-169724275 CGGTGCTGAGGCGGTGGCCGCGG - Intronic
1019278777 7:189469-189491 TTGTGCAGAGGCGGAGGGGCTGG - Intergenic
1019750861 7:2728835-2728857 CGGTCATGAGGAGGAGGAGGAGG + Exonic
1019903140 7:4040264-4040286 AAGTGCTCAGGCAGAGGAGCAGG - Intronic
1021588697 7:22237671-22237693 AGGTGCTGCAGCGGAGGAGTTGG - Intronic
1023132178 7:37014174-37014196 AGGGGCTGAGGAGGAGGAGGAGG - Intronic
1024046903 7:45591231-45591253 GGATGCTGGGGCTGAGGAGCAGG - Intronic
1024296304 7:47845438-47845460 TGGTGCTTAGGCAGAGGAGTTGG - Intronic
1024654800 7:51442569-51442591 GGGTGCTGCGGCTGAGGAGATGG + Intergenic
1024694981 7:51846766-51846788 CAGTGCTGGGGCAGAGGAGAGGG - Intergenic
1024995712 7:55271864-55271886 CCGTGGAGAGGCTGAGGAGCAGG + Intergenic
1025887703 7:65614060-65614082 TGGTGCTGGGGAGGAGCAGCTGG - Intergenic
1026025175 7:66738913-66738935 CTGTGCTGAGGAGGTGGAGGAGG - Intronic
1026046117 7:66906222-66906244 GGGTGCTGAGAGGCAGGAGCTGG - Intergenic
1026808643 7:73443983-73444005 TGATGCTGAGGTGGATGAGCTGG - Exonic
1027080103 7:75225807-75225829 TGGTGATGAGGAGGAGGAGGAGG + Intergenic
1027625819 7:80543808-80543830 GGGTGCTGTGGCTGAGGAGATGG + Intronic
1031854704 7:126907858-126907880 TGGTGCTGGGGAGGAGCAGCTGG + Intronic
1033390705 7:140924787-140924809 GGAGGCGGAGGCGGAGGAGCGGG + Intergenic
1033586699 7:142779651-142779673 CAGTGCTGTGATGGAGGAGCAGG - Intergenic
1033597779 7:142868956-142868978 CGCTGCTGAGGGGAAGGGGCAGG - Exonic
1033598168 7:142871034-142871056 TGGTGGAGAGGCGGAGGACCAGG - Exonic
1034115938 7:148583682-148583704 CGGTGGAGAGGCAGAGGAACTGG - Intergenic
1035010835 7:155713881-155713903 GCTTGCTGAGGGGGAGGAGCAGG + Intronic
1035041843 7:155934711-155934733 CAGTGATGAGGAGGAGGAGAAGG - Intergenic
1035041852 7:155934769-155934791 CAGTGATGAGGAGGAGGAGAAGG - Intergenic
1035041858 7:155934804-155934826 CAGTGATGAGGAGGAGGAGAAGG - Intergenic
1035041885 7:155935004-155935026 CAGTGATGAGGAGGAGGAGAAGG - Intergenic
1035093175 7:156331174-156331196 CGGTGCCGAGGCTGAGGATGGGG + Intergenic
1035375501 7:158404645-158404667 GGGAGCTGAGGCTGGGGAGCTGG - Intronic
1035375514 7:158404674-158404696 GGGAGCTGAGGCCAAGGAGCTGG - Intronic
1035375540 7:158404748-158404770 GGGAGCTGAGGCCGGGGAGCTGG - Intronic
1035375597 7:158404881-158404903 GGGAGCTGAGGCCGAGGAGCTGG - Intronic
1035375628 7:158404968-158404990 GGGAGCTGAGGCTGAGGAGCTGG - Intronic
1035375636 7:158404997-158405019 GGGAGCTGAGGCCGAGGAGCTGG - Intronic
1035375667 7:158405070-158405092 GGGAGCTGAGGCCGAGGAGCTGG - Intronic
1035579775 8:732153-732175 GGGTCCTGAGGGGGTGGAGCGGG - Intronic
1035616857 8:1008729-1008751 CAGTGCTGGGGTGGGGGAGCGGG - Intergenic
1037052172 8:14388305-14388327 AGGTGCTGAGGCCTAGGAGCTGG + Intronic
1037984126 8:23276192-23276214 GGGTGCGGAGGCGCAGGGGCTGG - Intronic
1038017773 8:23529467-23529489 CGGCGCTGAGGCGGGGGAGGCGG + Intronic
1038554085 8:28494433-28494455 GCGGGCTGAGGCGGAGCAGCAGG - Intronic
1040804389 8:51377849-51377871 TGGTGCTGTGGAGCAGGAGCAGG - Intronic
1040834523 8:51718267-51718289 AGGGACTGAGGGGGAGGAGCTGG + Intronic
1041447287 8:57966412-57966434 AAGTGCTCAGGCTGAGGAGCAGG - Intergenic
1042015292 8:64302511-64302533 CGGTGCTGAGTTGGAGGAATTGG + Intergenic
1044819463 8:96145725-96145747 CGGAGCTGACGCGAAGGAGGGGG - Intronic
1045430371 8:102108121-102108143 CCCAGCTGAGGCGGGGGAGCTGG - Intronic
1048533200 8:135269489-135269511 CAATGCTGAGGCGGGGGGGCGGG - Intergenic
1048607801 8:135987922-135987944 CTGTGATGAGGAGGAGGAGAAGG - Intergenic
1048994629 8:139786415-139786437 CGGTGGGGAGGCGGAGGAACTGG + Intronic
1049427043 8:142542359-142542381 CCGTGCTGAGGTGGATGAGGCGG - Exonic
1049649942 8:143761203-143761225 CGGCGGGGAGCCGGAGGAGCAGG - Intergenic
1049671917 8:143873718-143873740 CGGTGCCCAGGCTGAGGGGCGGG - Intronic
1049682417 8:143925500-143925522 CGGGGCTGAGGGGGAGCTGCAGG - Exonic
1049781480 8:144430969-144430991 ATGTGCTGGGGAGGAGGAGCTGG + Intronic
1051344479 9:16139940-16139962 CGGGGAGGAGGCGGAGGAACAGG - Intergenic
1051418976 9:16871511-16871533 CGGGGCTGGGGAGGAGGAACTGG - Intergenic
1053423744 9:37997706-37997728 CAGTCCTGAGGTGGTGGAGCTGG - Intronic
1053655173 9:40211653-40211675 TGGTGCTGCGGCCCAGGAGCTGG - Intergenic
1054367289 9:64357869-64357891 TGGTGCTGCGGCCCAGGAGCTGG - Intergenic
1054529426 9:66164661-66164683 TGGTGCTGCGGCCCAGGAGCTGG + Intergenic
1054674919 9:67847606-67847628 TGGTGCTGCGGCCCAGGAGCTGG - Intergenic
1056316303 9:85393804-85393826 GGGGGGGGAGGCGGAGGAGCAGG + Intergenic
1057173140 9:92975774-92975796 CAGTGGTGAGGAGGAGGAGGAGG + Intronic
1057872512 9:98728967-98728989 TGCGGCTGAGGCGGGGGAGCGGG + Intergenic
1058889086 9:109345460-109345482 CTGTGCTGAGGAGGACGAGGTGG - Intergenic
1059405934 9:114098434-114098456 CGCGGGTGGGGCGGAGGAGCGGG + Intronic
1060355734 9:122905319-122905341 CCGTGGTGAGGAGGAGGAGGAGG - Intronic
1060584478 9:124777448-124777470 CGGGGCCAGGGCGGAGGAGCCGG + Intronic
1060916905 9:127397328-127397350 CGGAGCGGACGCGGAGGGGCGGG - Intronic
1061070957 9:128310437-128310459 CTGTGCTCAAGCAGAGGAGCAGG + Intronic
1061382310 9:130265835-130265857 GGGTGCTGCGGTGGAGGCGCAGG - Intergenic
1061449385 9:130660241-130660263 CGGGGCTGGGGCGCAGGGGCTGG + Intergenic
1062127546 9:134871644-134871666 CGGTGCTGAGAGGGAGGATGTGG + Intergenic
1062344578 9:136109021-136109043 CAGGGCTGAGGAGGAGAAGCAGG - Intergenic
1062344597 9:136109076-136109098 CAGGGCTGAGGAGGAGAAGCAGG - Intergenic
1062495983 9:136831920-136831942 GGGTGCTGAGGCAGAGGCCCAGG + Intronic
1062635955 9:137491929-137491951 CTGTGCTGAGACGGAGATGCAGG + Intronic
1203662621 Un_KI270753v1:59577-59599 CGGTGCTGCAGCTGAGGAGATGG - Intergenic
1203670769 Un_KI270755v1:9252-9274 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1186768032 X:12791350-12791372 AGGAGCGGAGGGGGAGGAGCCGG - Intronic
1195668360 X:107449941-107449963 CGCTGAGGAGGCGGAGGAGGAGG + Intergenic
1196016380 X:110944547-110944569 CGCTGCTGGGCAGGAGGAGCAGG - Intronic
1196085882 X:111681730-111681752 AAGTGCTGAGGGGAAGGAGCCGG - Intronic
1200177171 X:154125439-154125461 CGGGGCTGAGGCTGGGGCGCGGG - Intergenic
1201274937 Y:12287855-12287877 CGGAGCTGAGTCGGGGGTGCAGG + Intergenic