ID: 1154356147

View in Genome Browser
Species Human (GRCh38)
Location 18:13624470-13624492
Sequence GGCCTCCGCCAGGGGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 224}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154356147_1154356159 16 Left 1154356147 18:13624470-13624492 CCTGCAGTCCCCTGGCGGAGGCC 0: 1
1: 0
2: 1
3: 19
4: 224
Right 1154356159 18:13624509-13624531 TCTCTCCATCTTCCTAGGGGAGG 0: 1
1: 0
2: 1
3: 16
4: 200
1154356147_1154356158 13 Left 1154356147 18:13624470-13624492 CCTGCAGTCCCCTGGCGGAGGCC 0: 1
1: 0
2: 1
3: 19
4: 224
Right 1154356158 18:13624506-13624528 CATTCTCTCCATCTTCCTAGGGG 0: 1
1: 0
2: 2
3: 28
4: 276
1154356147_1154356155 11 Left 1154356147 18:13624470-13624492 CCTGCAGTCCCCTGGCGGAGGCC 0: 1
1: 0
2: 1
3: 19
4: 224
Right 1154356155 18:13624504-13624526 GCCATTCTCTCCATCTTCCTAGG 0: 1
1: 0
2: 4
3: 33
4: 308
1154356147_1154356157 12 Left 1154356147 18:13624470-13624492 CCTGCAGTCCCCTGGCGGAGGCC 0: 1
1: 0
2: 1
3: 19
4: 224
Right 1154356157 18:13624505-13624527 CCATTCTCTCCATCTTCCTAGGG 0: 1
1: 0
2: 5
3: 32
4: 407
1154356147_1154356161 21 Left 1154356147 18:13624470-13624492 CCTGCAGTCCCCTGGCGGAGGCC 0: 1
1: 0
2: 1
3: 19
4: 224
Right 1154356161 18:13624514-13624536 CCATCTTCCTAGGGGAGGCTAGG 0: 1
1: 0
2: 0
3: 20
4: 146
1154356147_1154356163 23 Left 1154356147 18:13624470-13624492 CCTGCAGTCCCCTGGCGGAGGCC 0: 1
1: 0
2: 1
3: 19
4: 224
Right 1154356163 18:13624516-13624538 ATCTTCCTAGGGGAGGCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 108
1154356147_1154356165 28 Left 1154356147 18:13624470-13624492 CCTGCAGTCCCCTGGCGGAGGCC 0: 1
1: 0
2: 1
3: 19
4: 224
Right 1154356165 18:13624521-13624543 CCTAGGGGAGGCTAGGGGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 214
1154356147_1154356162 22 Left 1154356147 18:13624470-13624492 CCTGCAGTCCCCTGGCGGAGGCC 0: 1
1: 0
2: 1
3: 19
4: 224
Right 1154356162 18:13624515-13624537 CATCTTCCTAGGGGAGGCTAGGG 0: 1
1: 0
2: 1
3: 18
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154356147 Original CRISPR GGCCTCCGCCAGGGGACTGC AGG (reversed) Intronic
900142587 1:1144890-1144912 GACTCCCGCCAGGGGACTGAGGG - Intergenic
900191626 1:1354596-1354618 GGCCTCGGGCAAGGGACAGCGGG + Intronic
900488215 1:2933514-2933536 GCCCTCCTCCGGGGGTCTGCTGG - Intergenic
900786022 1:4651155-4651177 GACCTCCTGCAGGGGCCTGCTGG + Intergenic
901055355 1:6446591-6446613 AGCCTCAGCCAGGGGCCTGCAGG - Intronic
901865590 1:12104741-12104763 GGTCTATGCCAGGGGACAGCAGG - Intronic
902323551 1:15684243-15684265 CGCCTGCGCCTGGGGACTCCGGG - Intergenic
902479009 1:16701998-16702020 AGCCTCAGCCAGGCGCCTGCAGG + Intergenic
902535429 1:17116967-17116989 GCCCCCTGCCAGGGGACTGCTGG + Intronic
905468869 1:38176577-38176599 GGCCTCCCTCATGGGCCTGCAGG + Intergenic
906719741 1:47996708-47996730 GTCCTCCGTCCGGGGGCTGCGGG + Exonic
907238679 1:53068787-53068809 AGCCTACGCCACGGGACTGCTGG + Intronic
913680960 1:121186661-121186683 GGGCTCCGGGCGGGGACTGCAGG - Intronic
914032791 1:143974300-143974322 GGGCTCCGGGCGGGGACTGCAGG - Intergenic
915262679 1:154689394-154689416 GGCCTACGGCAGGGGGCTGTGGG - Intergenic
915340999 1:155176738-155176760 GGGCACCGCCCGGAGACTGCAGG + Intronic
919724515 1:200873181-200873203 GGCCTTCGCCGTGGGCCTGCTGG + Exonic
919756825 1:201071195-201071217 GGCCTCTGCCAGGGGCCAGGAGG - Intronic
920440931 1:205979915-205979937 GGCCTGAGCCTGGGAACTGCCGG - Intronic
920468272 1:206205185-206205207 GGGCTCCGGGCGGGGACTGCAGG - Intronic
921067083 1:211630820-211630842 GGCTTCAACCAGGGGATTGCTGG + Intergenic
923276999 1:232405188-232405210 GGCCTCTGTCAGGGCACTGACGG - Intronic
924412382 1:243819625-243819647 CCCCTCCGCCAAGGGACAGCTGG + Intronic
924739979 1:246789273-246789295 GGCCGCCCCCAGGGGCCTGCTGG - Intergenic
1062958063 10:1553047-1553069 GGTCTCCGGCAGGGAGCTGCGGG - Intronic
1063364051 10:5479093-5479115 GGGCTCAGCCAGGGGCCTCCAGG - Intergenic
1063945849 10:11175609-11175631 GGCCCCCTCCTGGGGACTGCTGG - Intronic
1064384673 10:14879240-14879262 GACCTCCAACCGGGGACTGCCGG - Intronic
1068254897 10:54496987-54497009 GTCCAGTGCCAGGGGACTGCAGG - Intronic
1070341550 10:75502885-75502907 TGCCTCTACCTGGGGACTGCAGG - Intronic
1073420511 10:103420478-103420500 AGGCTCTGCTAGGGGACTGCTGG - Intronic
1076300429 10:129421525-129421547 TGCCTCCTCCAGGGGCATGCAGG + Intergenic
1076839010 10:133036174-133036196 GGCCTCCCCCAGGGGCGGGCAGG + Intergenic
1076919935 10:133446181-133446203 GGGCTCCGCCAGGGCAGGGCTGG - Intergenic
1076919966 10:133446258-133446280 GGCCTCAGCCCGGGGACTCCAGG - Intergenic
1079102107 11:17548076-17548098 GGGATAGGCCAGGGGACTGCGGG + Intronic
1081567904 11:44270970-44270992 GCCCTGCTCCAGGGGGCTGCAGG - Intronic
1081858110 11:46316632-46316654 GGCCCCAGCTAGGGGACAGCTGG + Intronic
1082658043 11:55874572-55874594 GGCCGCCGGCATGGTACTGCTGG - Intergenic
1083331738 11:61901647-61901669 GCCCTGTGGCAGGGGACTGCGGG + Intronic
1083823115 11:65183462-65183484 CTCCTGCCCCAGGGGACTGCTGG + Exonic
1084183616 11:67458722-67458744 GGCCTCCCCCAGGAGCCTCCAGG + Exonic
1084356337 11:68641287-68641309 AGCTTCCACCAGGGTACTGCAGG + Intergenic
1084385053 11:68838326-68838348 GGCCTCAGCCCAGGGCCTGCTGG + Intronic
1084592858 11:70100465-70100487 GGCCACAGCCAGGGGACGCCTGG + Intronic
1085734925 11:79030855-79030877 GGCCCCCGCCAAGGCCCTGCTGG + Intronic
1089287273 11:117415690-117415712 GGCCTCATCCAGAGGGCTGCTGG + Intergenic
1089453236 11:118610906-118610928 GGCCTCCGCCACTCGGCTGCCGG + Intronic
1091791722 12:3275746-3275768 GGGCTGCGCCAGGGGACAGGAGG + Intronic
1092892934 12:12986215-12986237 GTCCTAGGCCAGGTGACTGCAGG - Intronic
1096258597 12:50077409-50077431 AGCCTCTGCCAGGGGATTCCTGG + Intronic
1096725326 12:53556753-53556775 GGCCTAAGCCAGGGGGCTGTGGG + Intronic
1097186677 12:57199926-57199948 GCCCTCCCCCGGGGGACAGCAGG - Exonic
1098356854 12:69620201-69620223 AGCCTCTGCCAGGGGACAGTTGG + Intergenic
1100607173 12:96161306-96161328 GGCCTCAACCAGGTGACAGCAGG - Intergenic
1102197315 12:111034548-111034570 GGCCTCGGGCAGGGGGCTGCTGG + Intronic
1102502816 12:113364259-113364281 GGCCTCCTCCAGGGCACACCTGG - Intronic
1102618315 12:114173903-114173925 GGCCTTCCCCAGGTGAGTGCAGG + Intergenic
1108484402 13:50909940-50909962 GGCCTCCTCCCGGGCGCTGCCGG + Exonic
1118292651 14:64540546-64540568 GGCCCCCGCCAGGAGACAGAGGG - Intronic
1119215240 14:72864398-72864420 GGCCTCCTCCACTGGACTGCGGG + Intronic
1119770745 14:77219411-77219433 GGTCTCCCCCAAGGGAATGCAGG + Intronic
1121643136 14:95499742-95499764 GGGCTCTGCTAAGGGACTGCTGG - Intergenic
1124151212 15:27180075-27180097 GGCCTTCCCCAGGAGACTGTGGG + Intronic
1124203434 15:27697806-27697828 GGCATCTGCCAGAGGACTGCAGG + Intergenic
1127084085 15:55408451-55408473 GGCCGCCGCCGGGCGGCTGCGGG + Intronic
1127978414 15:64016098-64016120 GGCTGGCTCCAGGGGACTGCAGG + Intronic
1128501447 15:68229805-68229827 GGGCTCCGCTAGGGGAGGGCCGG + Intronic
1128865940 15:71115369-71115391 GGTCGCCGCCAGGGGGCGGCAGG + Exonic
1130146875 15:81281198-81281220 GGCCTCCCTCATGGGACTGCTGG + Intronic
1130543806 15:84840476-84840498 GGCCTGGGCCAGGGGCCTTCTGG - Exonic
1131827183 15:96331213-96331235 GGCCTCCACCCAGCGACTGCGGG + Exonic
1132250654 15:100333334-100333356 GCCCTGAGCCAGGGGGCTGCAGG - Intronic
1132912391 16:2321185-2321207 TGCCTGCAGCAGGGGACTGCAGG - Intronic
1133008525 16:2897682-2897704 GTCCTCCTGCAGGGGACAGCAGG - Intronic
1137714817 16:50592229-50592251 TGCCGCCGCCTGGGGGCTGCTGG + Intronic
1138193936 16:55038604-55038626 GGCCTTTGCCAGGGCACTGAGGG + Intergenic
1139448761 16:67014364-67014386 CGCCCCCGCCTGGAGACTGCTGG - Intergenic
1139579100 16:67861632-67861654 GGCCTCAGCCTGCGGACTGTTGG + Intronic
1141090035 16:81123837-81123859 GGCCTCAGTCAAGGGGCTGCCGG - Intergenic
1142018427 16:87765192-87765214 GTCCTCAGCCCGGGGTCTGCAGG - Intronic
1142350066 16:89575726-89575748 GGCCGCCGCGCGGGGACTGCAGG - Intergenic
1142468339 17:148312-148334 GGCCTCCGCCGGGGGCCAGGAGG + Intronic
1142585031 17:966956-966978 GTCCTCTCCCAGGGGACCGCTGG - Intronic
1143053014 17:4142481-4142503 GGTCGCCCCCAGGGGACTGAAGG - Intronic
1143204589 17:5133101-5133123 GTCCTCGCCCAGAGGACTGCAGG + Intronic
1145262656 17:21364107-21364129 TGCCTCAGCCTGGGGCCTGCAGG + Intergenic
1145611134 17:25576639-25576661 GGCCTCCGCAAGGGGACATGTGG + Intergenic
1146055203 17:29577517-29577539 GGCCTCCCTCAGGGCACAGCTGG - Intronic
1146681961 17:34815005-34815027 GGGCTCCCCCAGGGGAATGTGGG - Intergenic
1146844071 17:36172721-36172743 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1146856376 17:36260656-36260678 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1146864240 17:36327719-36327741 GTCCTCGCCCAGAGGACTGCAGG + Intronic
1146872286 17:36384567-36384589 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1146879645 17:36435652-36435674 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1146883569 17:36456795-36456817 GTCCTCGCCCAGAGGACTGCAGG - Intergenic
1147067101 17:37928307-37928329 GTCCTCGCCCAGAGGACTGCAGG + Intronic
1147075170 17:37985191-37985213 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1147078633 17:38007868-38007890 GTCCTCGCCCAGAGGACTGCAGG + Intronic
1147086695 17:38064737-38064759 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1147094571 17:38131803-38131825 GTCCTCGCCCAGAGGACTGCAGG + Intergenic
1147102640 17:38188700-38188722 GTCCTCGCCCAGAGGACTGCAGG - Intergenic
1147200734 17:38799667-38799689 GGACGGGGCCAGGGGACTGCAGG - Exonic
1147356653 17:39903648-39903670 CTCCACCCCCAGGGGACTGCAGG - Intergenic
1147879703 17:43645958-43645980 GGCCTCCGCCGGGGGATGGAAGG + Intronic
1148458230 17:47822261-47822283 GGCCTCAGTGTGGGGACTGCTGG - Intergenic
1149847213 17:60015167-60015189 GTCCTCGCCCAGAGGACTGCAGG - Intergenic
1150085572 17:62271784-62271806 GTCCTCGCCCAGAGGACTGCAGG - Intergenic
1150228630 17:63537962-63537984 GTCCTTCACCAGGGGGCTGCTGG + Intronic
1151234056 17:72705698-72705720 GGGTTCCCCCAGGGAACTGCTGG - Intronic
1152541967 17:80981258-80981280 GGCCTCCCTTAGGGGTCTGCGGG + Intergenic
1152782331 17:82231844-82231866 GGGCTGCGCGAGGGGTCTGCGGG + Intronic
1152844839 17:82593431-82593453 GGGCTCCGCCAGGGGGGCGCGGG - Intronic
1152870722 17:82751789-82751811 GGCCGCCGCCGGAGGACAGCGGG - Intergenic
1152892302 17:82889388-82889410 GGCCTCCGCGTGGGTGCTGCTGG + Intronic
1153667493 18:7379329-7379351 GGCTTCCACCTGGGGATTGCTGG - Intergenic
1153985204 18:10344842-10344864 GGGCTCCAGCATGGGACTGCCGG + Intergenic
1154356147 18:13624470-13624492 GGCCTCCGCCAGGGGACTGCAGG - Intronic
1154381255 18:13852021-13852043 GGCCTTTGCCTGGGGACTGTTGG - Intergenic
1160500600 18:79399753-79399775 GGCCTCCTGCAGGGGGTTGCAGG + Intronic
1160832005 19:1108520-1108542 GGCCTCGGCCGGGGGGCTGTAGG + Exonic
1160955966 19:1691828-1691850 GGTCTCAGCCAGGGCCCTGCCGG + Intergenic
1161013066 19:1969406-1969428 GGACACAGCCAGGAGACTGCTGG - Intronic
1161683410 19:5691715-5691737 GGCACCAGACAGGGGACTGCGGG - Intronic
1162753343 19:12841953-12841975 GGACTGAGCGAGGGGACTGCTGG + Intronic
1163294199 19:16401706-16401728 GGCCTGGGGCAGGGGACTGTCGG - Intronic
1166759917 19:45218007-45218029 GGCCCCTGCCCGGGGTCTGCGGG - Intronic
1167032959 19:46975603-46975625 GGCCTCTGCCAGAGGACTTGGGG - Intronic
1167289107 19:48614885-48614907 GACCTCCTCCAGGGGCCTGTGGG - Intergenic
1168057034 19:53869639-53869661 GGTCACCGCCAGGGCCCTGCTGG + Intronic
1168282064 19:55311290-55311312 GGTCTCCGCCACGGGACCTCAGG + Intronic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
1202713050 1_KI270714v1_random:27905-27927 AGCCTCAGCCAGGCGCCTGCAGG + Intergenic
925201009 2:1967852-1967874 GGCCTCCTGCAGGGGAGGGCAGG + Intronic
928944528 2:36760797-36760819 GGGCTGCCCCAGGGGGCTGCTGG - Intronic
933733525 2:85476816-85476838 GGCCTCAGCCAGAGGATTGCTGG - Intergenic
935271100 2:101435142-101435164 GGCCTGAGCCTGGGGAATGCAGG - Intronic
935593802 2:104864113-104864135 CGTCTCCGCCCGAGGACTGCAGG + Intergenic
935754267 2:106264956-106264978 TGCCCCTGTCAGGGGACTGCAGG + Intergenic
938074016 2:128322483-128322505 GGCCGCTGCCCGGGGACAGCAGG + Intergenic
943351867 2:186805867-186805889 GGCCCCTGGCTGGGGACTGCAGG - Intergenic
945884163 2:215357183-215357205 TGCCTTTGCCAGGAGACTGCTGG - Intergenic
947589609 2:231378099-231378121 GGCTTCTGCCAGTGGAGTGCTGG - Intergenic
947614482 2:231546434-231546456 GGCCTCCGCCACTGGCCTCCAGG + Intergenic
947640924 2:231707596-231707618 AGCCTCCTCCAGGGGCCTGCCGG - Intronic
948143723 2:235692980-235693002 GGCCTCAGCCACTGGCCTGCAGG - Intronic
948625745 2:239266875-239266897 GGCCTTCCCCAGGGGACACCAGG + Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1169282581 20:4280094-4280116 GGCTTCCTCCAGGGGCCTGGAGG + Intergenic
1170727253 20:18941236-18941258 GGCCCCTGCCAGGTGACAGCTGG + Intergenic
1171455807 20:25271577-25271599 CGCCCCCGCCAGGGGACTGCAGG + Intronic
1173165381 20:40683737-40683759 GGCCTCCTCCAAGGAGCTGCCGG + Intergenic
1174576829 20:51542804-51542826 GGCCGCCACCAGGGGACCGGAGG + Intronic
1175159141 20:56995142-56995164 GGCCTCCTCCAGGGGGTTGGAGG + Intergenic
1175870350 20:62206405-62206427 GGCGTCCACCTGGGGACCGCAGG + Intergenic
1176059519 20:63166291-63166313 GGCCTCCACCAGGGCTGTGCGGG + Intergenic
1176091993 20:63322296-63322318 GGCCTCCCCCATGTGCCTGCAGG + Intronic
1176242164 20:64080106-64080128 GGCCACCCCCAGGCGACTGTGGG - Intergenic
1178859844 21:36279531-36279553 GGCCACCCCCAGAGGGCTGCTGG + Intronic
1179392367 21:41005358-41005380 GGCTTCCCCCAGGGGTCTGCAGG - Intergenic
1179572853 21:42288085-42288107 AGCCTCCCCCAGGGGGCTTCGGG - Intronic
1180115854 21:45704484-45704506 CGCCTCTGCCAGGGGAGAGCAGG - Intronic
1180223530 21:46375563-46375585 AGCCTCTGCCAGGGGGTTGCAGG + Intronic
1180901577 22:19377035-19377057 GGCCTTCCTCAGGGGACTGGGGG + Intronic
1181047685 22:20223357-20223379 GGGCTGCCCCAGGTGACTGCAGG - Intergenic
1181178646 22:21052337-21052359 GGCATTTGCCAGGGGACTGGAGG + Exonic
1181315514 22:21968518-21968540 GCCCTCAGCCCGGGGCCTGCCGG + Intronic
1181476920 22:23174144-23174166 GGCCTCCGGGAGGGGTTTGCTGG + Intergenic
1183521104 22:38296501-38296523 TGCTTCTGCCAGGGGACTGCTGG + Intronic
1184086793 22:42270366-42270388 GGCCTCCGCCGGGGGCGGGCGGG + Intronic
1184160149 22:42692949-42692971 GGCCACGTCCAGGGCACTGCTGG - Exonic
1184287370 22:43479120-43479142 GGCCGGCGCCAGGGGAGTGGAGG - Intronic
1184943283 22:47783959-47783981 GGCATCCTCCAGTGGACTCCAGG + Intergenic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
950518719 3:13483594-13483616 GGCCTGGGGCAGGGGGCTGCTGG + Intronic
950628824 3:14267862-14267884 GGGCTCAGGCAGGGGACAGCAGG - Intergenic
950900578 3:16493665-16493687 GGTCTCCAGCAGGGGCCTGCAGG - Intronic
953414639 3:42708714-42708736 CGCCTCTGCCAGTGGGCTGCTGG + Exonic
954378852 3:50209039-50209061 GGCCGCCTCCAGGGGATTCCGGG + Intronic
960877435 3:122311208-122311230 GGCCTGAGCCAGGGTAGTGCAGG + Intergenic
968356744 3:198113920-198113942 GCCCTCTGCAAGGGGCCTGCTGG + Intergenic
968509756 4:990385-990407 GGCTCCCGCCAGGCGCCTGCTGG - Intronic
970364312 4:15342630-15342652 GGCCTCTGCCTGGGGACCCCTGG - Intronic
970538681 4:17055832-17055854 GGCATCAGGCAGGGAACTGCAGG - Intergenic
973531730 4:51842946-51842968 GGCCTCCGCCAGGGGCGTTACGG + Intergenic
976049666 4:80996743-80996765 TGACTCCTCCAGGAGACTGCAGG - Intergenic
976861578 4:89672118-89672140 GGCATCTGGCAGGTGACTGCTGG + Intergenic
981654878 4:147101784-147101806 GGGTTTCGCCAGGGGACTTCTGG + Intergenic
990863577 5:60355391-60355413 GCCCTCTGCCAGGAGACTGTAGG - Intronic
992228567 5:74641425-74641447 GCCCTAAGCCAGGCGACTGCAGG + Intronic
997459023 5:134039778-134039800 TGCCTCCTCCTGGAGACTGCAGG - Intergenic
998383650 5:141743457-141743479 GGCCGCCGGCAGGTGTCTGCTGG + Intergenic
1000160922 5:158597193-158597215 GGCCTCAGGTAAGGGACTGCAGG + Intergenic
1001237765 5:170044556-170044578 GGGCTGGGCCAGGGGACTGTTGG - Intronic
1004380929 6:15131936-15131958 GCCCTCCCCCAGGTGACTCCAGG + Intergenic
1005855839 6:29862762-29862784 GGCCTCCACCTGGGAAATGCTGG - Intergenic
1005947200 6:30603176-30603198 GGCCAGCCCCAGGGGACTGGGGG - Intronic
1005984117 6:30859883-30859905 GACCTCTGCTAGGGCACTGCGGG - Intergenic
1007754112 6:44087680-44087702 GGACTCTACCAGGAGACTGCTGG + Intergenic
1016969531 6:149749598-149749620 TACCGCTGCCAGGGGACTGCAGG - Exonic
1018939815 6:168301675-168301697 GGCCTCCAACAGGGCACAGCTGG + Intronic
1018942495 6:168319008-168319030 GACCTCCGCCAGGGGAACGCCGG + Intronic
1019368002 7:645108-645130 GGCCTCCGCGAGGGGTGTGAGGG - Intronic
1019432847 7:1007411-1007433 GTCCTCAGCCTGGGGGCTGCTGG - Intronic
1023041188 7:36174543-36174565 GGTCTCCGCCAGGCAGCTGCTGG + Intronic
1023371109 7:39512970-39512992 GGCCATGGCCAGAGGACTGCTGG - Intergenic
1023386889 7:39667509-39667531 GGCCTCCCTCACGGGAATGCTGG - Intronic
1023935665 7:44738109-44738131 GGCCACAGCCAGGGGCCTGCTGG + Intergenic
1024354014 7:48396065-48396087 GGCTCCCACCAGGGCACTGCCGG + Intronic
1026976924 7:74504591-74504613 GGCCTCAGCCAGTGCACAGCGGG - Intronic
1034680677 7:152925445-152925467 GGCCTCTGCTGGGGGACGGCGGG + Intergenic
1034974093 7:155437952-155437974 AGCCGACTCCAGGGGACTGCGGG + Intergenic
1035203867 7:157282185-157282207 GGGCTGGGCCAGGGGACTGGCGG + Intergenic
1035319940 7:158022314-158022336 GGCCTCCACCACGAGACTTCAGG + Intronic
1036182133 8:6594671-6594693 GTTCTCCTGCAGGGGACTGCAGG + Intronic
1036219594 8:6910329-6910351 AGCGTCCGCCAGGGGACATCTGG - Intergenic
1036416506 8:8554536-8554558 GCTCTCCTCCAGGGGCCTGCAGG - Intergenic
1037822461 8:22141595-22141617 TGCCTCCGCCGAGGGACAGCCGG - Exonic
1039894990 8:41710718-41710740 GTCCTCAGCCAGAGGAATGCTGG - Intronic
1040572230 8:48621237-48621259 GGCCTCAGAGAGGGGGCTGCTGG + Intergenic
1044572327 8:93734143-93734165 GGCCTCCCCCAGAGCACTTCCGG - Exonic
1044638414 8:94352589-94352611 GGACTCTGGCAGGGGACTGCCGG + Intergenic
1049409336 8:142465401-142465423 GGCCTGGGGCTGGGGACTGCAGG + Intronic
1050599430 9:7235413-7235435 GGCTTCCACCAGGGGACCACAGG + Intergenic
1053408745 9:37901119-37901141 GGCCTCCCAAAGGGGACTACAGG + Intronic
1057907745 9:98995342-98995364 GGCTTACGCCAGGTGACTGGGGG - Intronic
1060667149 9:125438785-125438807 GGCCTCCCCCCGAGGACTTCAGG + Exonic
1060941656 9:127546079-127546101 GGCCTTGGCCAGGGGGCCGCAGG - Intronic
1061134259 9:128724159-128724181 CGCCGCCGCCCGGGGACTGGTGG + Intergenic
1061418388 9:130460489-130460511 GGTCTGTGCCAGGGAACTGCGGG + Intronic
1061614629 9:131771860-131771882 GGCATGGGCCAGGGGTCTGCAGG - Intergenic
1061926406 9:133808131-133808153 AGCCTCTGCCAGGGCCCTGCTGG - Intronic
1062489640 9:136799028-136799050 AGCCTCCCCCAGGGGATTCCAGG + Intronic
1062574867 9:137201285-137201307 GACCTCCGGCAGGTGCCTGCGGG + Intronic
1190064271 X:47229590-47229612 GGCCCCAGCTACGGGACTGCAGG - Exonic
1190203244 X:48381701-48381723 TGCCTCGGCCTCGGGACTGCAGG - Intergenic
1190207292 X:48413703-48413725 TGCCTCGGCCTCGGGACTGCAGG + Intergenic
1190333647 X:49250211-49250233 GCCCTCCGCCAGGAGAACGCTGG + Exonic
1190649732 X:52557151-52557173 CACCTCTGCCAGGGGACTCCAGG - Intergenic
1192212694 X:69137673-69137695 GGCCTAACCCAGGGGTCTGCAGG + Intergenic
1195014741 X:100766870-100766892 GGCCACAGACAGTGGACTGCAGG - Intergenic
1195379807 X:104259857-104259879 GCCCTCAGCCAGGGGAAAGCAGG - Intergenic
1200108082 X:153725386-153725408 GGCCCCGGCCAGGGGTCTTCAGG + Exonic
1200210663 X:154345423-154345445 GGCCCCCAACAGGGGACGGCTGG - Intergenic
1200220189 X:154386669-154386691 GGCCCCCAACAGGGGACGGCTGG + Intergenic