ID: 1154356576

View in Genome Browser
Species Human (GRCh38)
Location 18:13626428-13626450
Sequence CTGGGCTGTCCACACAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154356576_1154356592 25 Left 1154356576 18:13626428-13626450 CCTGGCCTGTGTGGACAGCCCAG No data
Right 1154356592 18:13626476-13626498 AGGGTCTGGCCATCAGCGGATGG No data
1154356576_1154356594 29 Left 1154356576 18:13626428-13626450 CCTGGCCTGTGTGGACAGCCCAG No data
Right 1154356594 18:13626480-13626502 TCTGGCCATCAGCGGATGGAGGG No data
1154356576_1154356587 -2 Left 1154356576 18:13626428-13626450 CCTGGCCTGTGTGGACAGCCCAG No data
Right 1154356587 18:13626449-13626471 AGGGGTAGGGGATGGCATGCAGG No data
1154356576_1154356593 28 Left 1154356576 18:13626428-13626450 CCTGGCCTGTGTGGACAGCCCAG No data
Right 1154356593 18:13626479-13626501 GTCTGGCCATCAGCGGATGGAGG No data
1154356576_1154356588 5 Left 1154356576 18:13626428-13626450 CCTGGCCTGTGTGGACAGCCCAG No data
Right 1154356588 18:13626456-13626478 GGGGATGGCATGCAGGCAGAAGG No data
1154356576_1154356591 21 Left 1154356576 18:13626428-13626450 CCTGGCCTGTGTGGACAGCCCAG No data
Right 1154356591 18:13626472-13626494 CAGAAGGGTCTGGCCATCAGCGG No data
1154356576_1154356584 -10 Left 1154356576 18:13626428-13626450 CCTGGCCTGTGTGGACAGCCCAG No data
Right 1154356584 18:13626441-13626463 GACAGCCCAGGGGTAGGGGATGG No data
1154356576_1154356590 11 Left 1154356576 18:13626428-13626450 CCTGGCCTGTGTGGACAGCCCAG No data
Right 1154356590 18:13626462-13626484 GGCATGCAGGCAGAAGGGTCTGG No data
1154356576_1154356589 6 Left 1154356576 18:13626428-13626450 CCTGGCCTGTGTGGACAGCCCAG No data
Right 1154356589 18:13626457-13626479 GGGATGGCATGCAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154356576 Original CRISPR CTGGGCTGTCCACACAGGCC AGG (reversed) Intronic