ID: 1154360113

View in Genome Browser
Species Human (GRCh38)
Location 18:13653899-13653921
Sequence CCAGGGACAGTGGGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154360113_1154360125 28 Left 1154360113 18:13653899-13653921 CCTCTCTCCCCCACTGTCCCTGG No data
Right 1154360125 18:13653950-13653972 CTGTCTCAGAGCCAAGGATGTGG No data
1154360113_1154360124 22 Left 1154360113 18:13653899-13653921 CCTCTCTCCCCCACTGTCCCTGG No data
Right 1154360124 18:13653944-13653966 TAGAAGCTGTCTCAGAGCCAAGG No data
1154360113_1154360126 29 Left 1154360113 18:13653899-13653921 CCTCTCTCCCCCACTGTCCCTGG No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154360113 Original CRISPR CCAGGGACAGTGGGGGAGAG AGG (reversed) Intergenic