ID: 1154360121

View in Genome Browser
Species Human (GRCh38)
Location 18:13653916-13653938
Sequence ACAGCTGGTACAGCCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154360121_1154360128 27 Left 1154360121 18:13653916-13653938 CCCTGGGAGGCTGTACCAGCTGT No data
Right 1154360128 18:13653966-13653988 GATGTGGGAACTGTTAGCAGAGG No data
1154360121_1154360126 12 Left 1154360121 18:13653916-13653938 CCCTGGGAGGCTGTACCAGCTGT No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data
1154360121_1154360124 5 Left 1154360121 18:13653916-13653938 CCCTGGGAGGCTGTACCAGCTGT No data
Right 1154360124 18:13653944-13653966 TAGAAGCTGTCTCAGAGCCAAGG No data
1154360121_1154360125 11 Left 1154360121 18:13653916-13653938 CCCTGGGAGGCTGTACCAGCTGT No data
Right 1154360125 18:13653950-13653972 CTGTCTCAGAGCCAAGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154360121 Original CRISPR ACAGCTGGTACAGCCTCCCA GGG (reversed) Intergenic