ID: 1154360123

View in Genome Browser
Species Human (GRCh38)
Location 18:13653931-13653953
Sequence ACAGCTTCTAAAGTGACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154360123_1154360125 -4 Left 1154360123 18:13653931-13653953 CCAGCTGTCACTTTAGAAGCTGT No data
Right 1154360125 18:13653950-13653972 CTGTCTCAGAGCCAAGGATGTGG No data
1154360123_1154360128 12 Left 1154360123 18:13653931-13653953 CCAGCTGTCACTTTAGAAGCTGT No data
Right 1154360128 18:13653966-13653988 GATGTGGGAACTGTTAGCAGAGG No data
1154360123_1154360129 19 Left 1154360123 18:13653931-13653953 CCAGCTGTCACTTTAGAAGCTGT No data
Right 1154360129 18:13653973-13653995 GAACTGTTAGCAGAGGAAACAGG No data
1154360123_1154360124 -10 Left 1154360123 18:13653931-13653953 CCAGCTGTCACTTTAGAAGCTGT No data
Right 1154360124 18:13653944-13653966 TAGAAGCTGTCTCAGAGCCAAGG No data
1154360123_1154360126 -3 Left 1154360123 18:13653931-13653953 CCAGCTGTCACTTTAGAAGCTGT No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154360123 Original CRISPR ACAGCTTCTAAAGTGACAGC TGG (reversed) Intergenic