ID: 1154360126

View in Genome Browser
Species Human (GRCh38)
Location 18:13653951-13653973
Sequence TGTCTCAGAGCCAAGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154360119_1154360126 20 Left 1154360119 18:13653908-13653930 CCCACTGTCCCTGGGAGGCTGTA No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data
1154360113_1154360126 29 Left 1154360113 18:13653899-13653921 CCTCTCTCCCCCACTGTCCCTGG No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data
1154360118_1154360126 21 Left 1154360118 18:13653907-13653929 CCCCACTGTCCCTGGGAGGCTGT No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data
1154360123_1154360126 -3 Left 1154360123 18:13653931-13653953 CCAGCTGTCACTTTAGAAGCTGT No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data
1154360122_1154360126 11 Left 1154360122 18:13653917-13653939 CCTGGGAGGCTGTACCAGCTGTC No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data
1154360117_1154360126 22 Left 1154360117 18:13653906-13653928 CCCCCACTGTCCCTGGGAGGCTG No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data
1154360121_1154360126 12 Left 1154360121 18:13653916-13653938 CCCTGGGAGGCTGTACCAGCTGT No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data
1154360120_1154360126 19 Left 1154360120 18:13653909-13653931 CCACTGTCCCTGGGAGGCTGTAC No data
Right 1154360126 18:13653951-13653973 TGTCTCAGAGCCAAGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154360126 Original CRISPR TGTCTCAGAGCCAAGGATGT GGG Intergenic