ID: 1154361135

View in Genome Browser
Species Human (GRCh38)
Location 18:13662057-13662079
Sequence TCTGGACTTGAATGGTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154361135_1154361141 -9 Left 1154361135 18:13662057-13662079 CCCCCAGACCATTCAAGTCCAGA No data
Right 1154361141 18:13662071-13662093 AAGTCCAGAAAGGAAGAATGAGG No data
1154361135_1154361144 15 Left 1154361135 18:13662057-13662079 CCCCCAGACCATTCAAGTCCAGA No data
Right 1154361144 18:13662095-13662117 CTTGACTCCCATTGTCCTCAGGG No data
1154361135_1154361143 14 Left 1154361135 18:13662057-13662079 CCCCCAGACCATTCAAGTCCAGA No data
Right 1154361143 18:13662094-13662116 TCTTGACTCCCATTGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154361135 Original CRISPR TCTGGACTTGAATGGTCTGG GGG (reversed) Intergenic
No off target data available for this crispr