ID: 1154365146

View in Genome Browser
Species Human (GRCh38)
Location 18:13701185-13701207
Sequence CAGCTGCTCTGAGGGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 12, 2: 26, 3: 56, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154365146_1154365153 7 Left 1154365146 18:13701185-13701207 CCTTTGATCCCTCAGAGCAGCTG 0: 1
1: 12
2: 26
3: 56
4: 252
Right 1154365153 18:13701215-13701237 TGGTAAGTTCTCTCAGATTTCGG 0: 1
1: 0
2: 2
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154365146 Original CRISPR CAGCTGCTCTGAGGGATCAA AGG (reversed) Intronic
903549836 1:24150282-24150304 CATCTGCTCTGAGGGGGCACTGG - Intergenic
904013755 1:27405240-27405262 CAGCTGCTCTGAGCCTCCAAGGG + Exonic
904391862 1:30191287-30191309 AAGCTGCTCTGAGTCATCACTGG - Intergenic
906331273 1:44887025-44887047 CAGTCACTCTGAGAGATCAATGG - Intronic
906380846 1:45331498-45331520 AAGCTGCTCTGAGGGCTCCCAGG + Exonic
907212423 1:52835132-52835154 CAGCCACTCTGAGAGATCCATGG + Intergenic
907917129 1:58881566-58881588 CAGCTGGACTGAGGGATCCCTGG + Intergenic
908733605 1:67252556-67252578 CAGCCACTCTGAGAGATCAAAGG + Intronic
908764293 1:67540194-67540216 CTGCTGCTCCGATGGATCACTGG + Intergenic
909255402 1:73414384-73414406 CAGCTGCTCTAAGAGATTAATGG - Intergenic
909485129 1:76164203-76164225 CTGCTGCTGTGAGGGTGCAAAGG + Intronic
910605644 1:89080658-89080680 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
911116259 1:94249064-94249086 CATCTGCTATGTGGGATAAATGG + Intronic
913319054 1:117576016-117576038 CAGCTGGTCTGAGACAGCAAAGG + Intergenic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
915747013 1:158169533-158169555 CAGTTGCTATGAGAGATCAATGG - Intergenic
916290284 1:163158469-163158491 CAGCTGGTCTGAGAAATAAAGGG + Intronic
916626865 1:166567557-166567579 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
918045149 1:180936826-180936848 GAGCTGCTCTGAGGTGTCAGGGG + Intronic
918326606 1:183417141-183417163 CAGCTGCTCGTAGGACTCAAAGG - Intronic
918464847 1:184810951-184810973 CAGCCGCTCTGAGAGATCAATGG - Intronic
919383325 1:196886363-196886385 CAGCTGGTCTGAGAAATAAAGGG + Intronic
922705273 1:227787255-227787277 CAGCTAGTCTGAGGGAACCAGGG + Intergenic
922759825 1:228121068-228121090 CAGCTGCTCCAAGAGATCAGTGG + Intergenic
922848119 1:228706145-228706167 CAGCTGCTGTGAGAGAGCAATGG + Intergenic
924120235 1:240790016-240790038 CAGCTGGTCTGAGAAATAAAGGG - Intronic
924358999 1:243215917-243215939 CAGCTGGTCTGAGAAATAAAGGG - Intronic
1062978939 10:1705746-1705768 GTGCTGCTCTGAGGGTTCCAGGG + Intronic
1063970337 10:11377268-11377290 CAGATGCTCTGAGGCCTCAGTGG - Intergenic
1064675660 10:17757483-17757505 CAGCTGCTCTGGGAGCTAAAGGG + Intronic
1065068078 10:21992655-21992677 GTGCTGCTCTAAGGGATCAATGG + Intronic
1066063614 10:31746038-31746060 CAGCTGCCCTGAAGGATGAGGGG - Intergenic
1067242676 10:44509351-44509373 CAGCTGCCCTTAGGGATCATGGG + Intergenic
1067542995 10:47170047-47170069 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1069185222 10:65414159-65414181 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1069749576 10:70736687-70736709 CAGCTGCTTGCAGGGCTCAAAGG - Exonic
1071524647 10:86351396-86351418 GAGGTGGGCTGAGGGATCAATGG + Intronic
1071868996 10:89771124-89771146 CATCAGCTATGAGGGCTCAAGGG - Intronic
1072070307 10:91908877-91908899 CGGCTGCTCGGAGGGAGAAAGGG - Exonic
1073678207 10:105673568-105673590 CAGTTGCTGTGAGAGAGCAATGG + Intergenic
1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG + Intergenic
1075658412 10:124176490-124176512 CAGCTGCTCTGATGTAACAGAGG + Intergenic
1076679468 10:132164223-132164245 CAGCCCCTCTGAGGCAGCAAAGG - Intronic
1077313450 11:1904116-1904138 CAGCTGCTCTGAGAGAGCAGAGG + Intergenic
1077487708 11:2846633-2846655 CACCTGCTCTGAGGGTGCCAGGG + Intronic
1077720361 11:4622073-4622095 CACTTGCTGTGAGGGAGCAATGG - Intergenic
1078530800 11:12135490-12135512 CACCTGCTCTGAGCAAGCAATGG + Intronic
1079130616 11:17744906-17744928 CAGCTGTGCTGAGGGGTGAAGGG - Intronic
1080623576 11:34008153-34008175 CAGCTGCTCTCAAGCATCAGAGG + Intergenic
1080811592 11:35709701-35709723 CAGCTACTCTGAGAGATCAGAGG + Intronic
1082956776 11:58878349-58878371 CAGCCACTCTGAGAGATCAATGG - Intronic
1082963684 11:58943634-58943656 CAGCCACTCTGAGAGATCAATGG - Exonic
1082966424 11:58970620-58970642 CAGCCACTCTGAGAGATCAATGG - Intronic
1082972761 11:59041154-59041176 CAGCTGCTCTGAGAGATCAGTGG - Intronic
1082977214 11:59085055-59085077 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1083011155 11:59400967-59400989 CAGCTGCTCTGAGAGATCAAAGG - Intergenic
1083328361 11:61885212-61885234 CAGCTGCTGTGTGGGATTCACGG - Intronic
1083750227 11:64756911-64756933 CAGCTACTCTGAGGCTTCAGTGG - Intronic
1085328230 11:75625047-75625069 CAGGTGCTCTGGGAGTTCAAGGG + Intronic
1085579925 11:77641313-77641335 CAGCTGCTGTGACAGATCAAAGG - Intergenic
1085743195 11:79094304-79094326 GAGCTGCTGTGAGGGATAAATGG - Intronic
1085959420 11:81443173-81443195 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1087227261 11:95615070-95615092 CAACTGCTCTGAGAGATCAATGG + Intergenic
1087525001 11:99298064-99298086 CAGCTGCTCTGAGAGATTAAAGG + Intronic
1088103979 11:106185297-106185319 CAGCCGCTCTGAGAAATCAATGG - Intergenic
1089102894 11:115978803-115978825 CAGGAGCTATGAGGGAACAAAGG - Intergenic
1089331312 11:117690865-117690887 CAGCTGCTCTGATGGAAGCAGGG - Intronic
1091806914 12:3363486-3363508 CTGCTGGTGTGAGGGATCCAGGG + Intergenic
1095046420 12:37512565-37512587 CAGCCACTTTGAGAGATCAAAGG - Intergenic
1096689121 12:53308640-53308662 ATGCAGCTCTGAGGGATAAAGGG - Intronic
1098293757 12:68983446-68983468 CAGCTGCTCCAAGAGATCAATGG - Intergenic
1098502147 12:71205741-71205763 CAGCTACTCTGAGACATCAGTGG - Intronic
1098781113 12:74687654-74687676 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1100279816 12:93107641-93107663 GAGCTGCTCTGAGCCATCAGTGG + Intergenic
1101188256 12:102304724-102304746 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1103218040 12:119218654-119218676 CAGCTGGTCTGAGAAATAAAGGG + Intronic
1109911836 13:68922914-68922936 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1112302203 13:98240441-98240463 CAGCTGTTCTGAGAGAAGAAGGG + Intronic
1112397958 13:99050769-99050791 CAGCTGCTCTAGGGGATAGATGG - Intronic
1112597476 13:100821493-100821515 CAGCTGCCTTCAGGCATCAAAGG - Intergenic
1116235571 14:42275005-42275027 CAGCTGCTCTTAGAGATCAATGG + Intergenic
1116310005 14:43312823-43312845 CAGCTGCTCCAAGAGACCAAAGG - Intergenic
1116678597 14:47937978-47938000 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1116791639 14:49345893-49345915 CAGCTGCTCTAAGATATGAAGGG + Intergenic
1118101348 14:62607031-62607053 GAACTGCTCTGAGAGGTCAAAGG + Intergenic
1118279462 14:64415200-64415222 CAGGTGCTCTCAGGATTCAAGGG + Intronic
1121584922 14:95056736-95056758 CACCTGCTCTGAGAAATGAAAGG - Intergenic
1122823543 14:104358990-104359012 CTGCTGTTCTGAGGGCTCAGCGG + Intergenic
1202840340 14_GL000009v2_random:115258-115280 CAGCTGCTCCGAGAGATCAAAGG - Intergenic
1202909723 14_GL000194v1_random:105456-105478 CAGCTGCTCCAAGAGATCAAAGG - Intergenic
1123845513 15:24297209-24297231 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1124040307 15:26095893-26095915 CTGCTGCCCTGAGAGAGCAACGG + Intergenic
1124240347 15:28023135-28023157 CAGGTGCTCTGAGATTTCAAAGG - Intronic
1124821043 15:33045483-33045505 CAGCCCCTCTGAGAGATCAAAGG - Intronic
1125574835 15:40748207-40748229 GAGCTGCTTTGAGGGATGAAGGG - Intronic
1128598750 15:68977178-68977200 CAGCTGGTCTGAGAAATAAAGGG + Intronic
1128988794 15:72241354-72241376 AGGCTGCCCTGAGGAATCAAGGG - Exonic
1131383285 15:91981900-91981922 CAGCTGCTTTGAGGGTCCATGGG - Intronic
1131666337 15:94574992-94575014 CAGCTTCTCTGAGAGAAGAAGGG + Intergenic
1133804306 16:9112421-9112443 CACCTGCGCTGGTGGATCAACGG + Intronic
1135014858 16:18916817-18916839 CAGCTCCTCTGAATCATCAAGGG + Intronic
1136104354 16:28018860-28018882 CAGCTGGGCTTGGGGATCAAAGG - Intronic
1136595375 16:31245413-31245435 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1138954723 16:61957235-61957257 TAGCTGCTCTCAGGAATCAAAGG + Intronic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1141952696 16:87348854-87348876 CAGTTGTTCTGCGGGATCCAGGG - Intronic
1143642388 17:8206542-8206564 AATCTGCTCTTAGGGCTCAAGGG - Exonic
1144726703 17:17505959-17505981 CAGTGGCTCTGGGGGATGAAGGG - Intronic
1145728215 17:27153419-27153441 CATCTTCTCTGGGGGATCCATGG - Intergenic
1146283249 17:31558900-31558922 CAGCTGCTCGGACGGGTCAAAGG + Intergenic
1146635684 17:34502666-34502688 CAGCTTCTCTGTGAGTTCAAGGG + Intergenic
1147951030 17:44108147-44108169 CATCTGCTCTTAGCGATCAGAGG - Intronic
1148907697 17:50921738-50921760 CAACCTCTCTGAGGGCTCAAGGG + Intergenic
1149224417 17:54452938-54452960 CAACTGCTCTGAGAGATCAGTGG - Intergenic
1151084657 17:71366424-71366446 CAGATGGTTTGAGGGCTCAAGGG - Intergenic
1151421687 17:74002387-74002409 CAACTGCTCTGATGCATCAGAGG + Intergenic
1151849326 17:76681095-76681117 CAGGTTCTGTGCGGGATCAAGGG - Intronic
1152522202 17:80863053-80863075 CAGAAGCTCTGAGGGATTCATGG + Intronic
1152589779 17:81205783-81205805 CAGCTGCTCCGAAGGCTGAAGGG + Intronic
1153117038 18:1670940-1670962 GATCTGCTCTGTGGGATCACTGG - Intergenic
1153118578 18:1691764-1691786 CAGCTGCTCTGAGAGAGCAATGG + Intergenic
1154365146 18:13701185-13701207 CAGCTGCTCTGAGGGATCAAAGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156907455 18:42370841-42370863 CTGCTCCTCTGAAGCATCAATGG + Intergenic
1157727904 18:49978951-49978973 CAGCTGCCCTGAGGAACCACAGG + Intronic
1159051671 18:63426271-63426293 TACCTGCTCTGAGGGATCCCTGG + Intergenic
1161516271 19:4698297-4698319 CAGCATCTCTGGAGGATCAAAGG + Intronic
1162153872 19:8663824-8663846 CACCTGCTCTGGGGGATGTAGGG + Intergenic
1164464363 19:28475051-28475073 AAGCTTCTCTGAGGGAGCAGGGG - Intergenic
1168584261 19:57579895-57579917 CAGCTGGTATGAAGGATCATAGG - Intronic
1168609251 19:57786225-57786247 CGGCTTCTCTGAGGCTTCAATGG - Intronic
1202632713 1_KI270706v1_random:15292-15314 CAGATGCTCTGAGAGGTCAAAGG + Intergenic
1202658992 1_KI270708v1_random:50988-51010 CAGCTGCTCCGAGAGGTCAAAGG + Intergenic
925770709 2:7280274-7280296 CAGGTGCTATGAGGCCTCAAAGG - Intergenic
926597363 2:14805819-14805841 GAGGTGCACTGAAGGATCAATGG - Intergenic
926820349 2:16844988-16845010 CAGCTACTCTGGAGGATCACTGG + Intergenic
927463606 2:23320909-23320931 CAGCAGCTTTGGGGGCTCAAGGG - Intergenic
928708419 2:33977209-33977231 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
930026372 2:47031648-47031670 CCGCTGCTCTGATGGAGCCAAGG + Intronic
930408995 2:50999587-50999609 CAGCTGGTCTGAGAAATAAAGGG - Intronic
931221853 2:60295585-60295607 CAGCCTCTGTGAGGGATGAAAGG - Intergenic
931503211 2:62894451-62894473 CAATTGATCTGAGTGATCAAAGG + Intronic
933611805 2:84444285-84444307 CAGCTGGTCTGAGAAATAAAGGG + Intronic
935079437 2:99777824-99777846 CATCTGCTCTGTGGGACCACCGG - Intronic
935179895 2:100679860-100679882 CATCTGCTCAGAGGGTTCAGGGG + Intergenic
935897420 2:107752877-107752899 CAGATGATCTCATGGATCAAGGG - Intergenic
936525880 2:113241459-113241481 CAGCTGCTTTGATGGAGCACAGG + Intronic
940499423 2:154475819-154475841 CAGCTGCTCCAAGAGAGCAATGG + Intergenic
941447629 2:165622533-165622555 CTGCTGCTGTGAAGGCTCAATGG + Intronic
941652933 2:168112864-168112886 CAGCTGCCCTGAGGGATCAGGGG + Intronic
943969506 2:194385676-194385698 CAACTGCTCTGAGAGTTCAAAGG + Intergenic
945357261 2:208855300-208855322 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
947270383 2:228327737-228327759 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
948352272 2:237350797-237350819 CGGCTGCTCTGATGGCTCAGAGG + Intronic
948509180 2:238451911-238451933 CACCTGCTCTGAGGGAACTTGGG + Exonic
1171319276 20:24225198-24225220 CAGTGGCTCTGAGAGATCAATGG + Intergenic
1171540984 20:25956178-25956200 CAGCCACTTTGAGAGATCAAGGG - Intergenic
1171800078 20:29604129-29604151 CAGCCACTTTGAGAGATCAAGGG + Intergenic
1171844009 20:30252549-30252571 CAGCCACTTTGAGAGATCAAGGG - Intergenic
1172313574 20:33936290-33936312 CAGCTCCCTTGAGGGATCAGAGG - Intergenic
1173207026 20:41003150-41003172 CAGTTGCTCAAAGGGATGAATGG + Intergenic
1173395788 20:42678125-42678147 CAGCAGCTCTGGGGGAGCAATGG + Exonic
1174602019 20:51732409-51732431 GACCTGCTCTGTGGGAACAAGGG - Intronic
1176063581 20:63182783-63182805 CAGATGCTCTGATGGAGCCATGG + Intergenic
1176239021 20:64067426-64067448 CAGCTACTCAGAGGGAACAGAGG + Intronic
1176629070 21:9120163-9120185 CAGCTGCTCAGAGAGATCAAAGG - Intergenic
1176644926 21:9341172-9341194 CAGATGCTCTGAGAGGTCAAAGG + Intergenic
1176879923 21:14179863-14179885 CAGCGGCTTTTAGGGAACAAGGG + Intronic
1177055925 21:16300814-16300836 CAGCTTGTGTGAGGGACCAAAGG - Intergenic
1179018710 21:37617886-37617908 GAGGTGCTCTGTGGGGTCAAGGG + Exonic
1180326456 22:11434504-11434526 CAGCTGCTCCAAGAGGTCAAAGG + Intergenic
1180368024 22:11958062-11958084 CAGATGCTCTGAGAGGTCAAAGG - Intergenic
1180378069 22:12113274-12113296 CAGCTGCTCTGAGAGGTCAAAGG + Intergenic
1180862109 22:19089483-19089505 CCGCAGCTCTGTGGGACCAAAGG + Exonic
1181454174 22:23046803-23046825 CAGTTGCTGTGAGAGAGCAATGG + Intergenic
1181464533 22:23103793-23103815 CAGCTGACCTGAGGGAGGAAGGG - Intronic
1182485989 22:30639121-30639143 CAGCTGGTCTGAGAAATAAAGGG + Intronic
1183060922 22:35335941-35335963 CAGCTGCTGTGCGGGAGCCAGGG - Intronic
1184925230 22:47631809-47631831 CAGGAGCTCTGAGGGATAACTGG - Intergenic
949638950 3:6013859-6013881 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
949963077 3:9330482-9330504 CAGCCACTCTGAGAGATCAATGG + Intronic
950053216 3:10007616-10007638 CAGCAGCCCTGAGGGATGGAGGG + Intronic
950198560 3:11026818-11026840 CAGCTGGTCTGAGAAATAAAGGG + Intronic
950570215 3:13795205-13795227 CAGCTCCTCTGAGGCTCCAAGGG - Intergenic
950605952 3:14080254-14080276 CAGCTGCTCTGAGAGATCAATGG + Intronic
951249761 3:20381272-20381294 GAGCCGCTCTGAGAGATCCATGG - Intergenic
952023968 3:29056715-29056737 CAGCTGCTTTGAGAGATCCATGG + Intergenic
954154720 3:48679104-48679126 CAGCTGCTCTGTGGTGTCCAAGG + Exonic
954471059 3:50695681-50695703 CAGCTGTTCTGAGAGAGGAATGG + Intronic
957095404 3:75772857-75772879 CAGCTGCTCTGAGAGGTCAAAGG - Intronic
957724383 3:84045696-84045718 CAGCTGCTCCCAGAGATCAATGG - Intergenic
960112795 3:113861854-113861876 CAGCTGGTCTGAGAAATAAAGGG + Intronic
960142024 3:114159987-114160009 CATCTGCCCTGTGGGAACAACGG - Intronic
960942985 3:122946642-122946664 CAGCTGGGCTGAGGGACCAAAGG + Intronic
961338161 3:126197689-126197711 CAGCCATTCTGAGAGATCAATGG + Intronic
961675268 3:128561065-128561087 CAGTGCCTCTGAGGGAGCAAAGG - Intergenic
961942799 3:130655553-130655575 CAGTTGCTGTGAGAGATCAATGG + Intronic
962993408 3:140601148-140601170 CAGGTGCTCTGCCCGATCAAGGG - Intergenic
965076406 3:163983160-163983182 GAGCTGCTCTGAGGGCTGGAGGG + Intergenic
965235297 3:166110616-166110638 CAGTTACTCTTAGGGAACAACGG - Intergenic
966875688 3:184320409-184320431 GGGCTGCTCTGTGAGATCAAGGG + Intronic
967291074 3:187920912-187920934 CTGCTGCTTTGAGAGACCAATGG - Intergenic
967411403 3:189169836-189169858 CAGCTGCTCACTGGGATCAGAGG - Intronic
967929924 3:194683628-194683650 CAGCTGCACTGATGGGTTAATGG - Intergenic
1202741965 3_GL000221v1_random:63896-63918 CAGATGCTCTGAGAGGTCAAAGG - Intergenic
968685169 4:1952988-1953010 CAGCTGCTCTCAAGGAGGAAAGG + Intronic
968698591 4:2044225-2044247 CAGCTGCTCTGGGGGCTCAGGGG - Intergenic
968847792 4:3056068-3056090 CAGCTGCTCTGAGAAATCAATGG + Intergenic
969600300 4:8172102-8172124 CAGCTGCTGTGAGGGAGCCGTGG + Intergenic
969677001 4:8619808-8619830 CAGCTGCCCTCAGGCAACAAGGG - Intergenic
972420428 4:38881491-38881513 CAGAAGCTCAGAGGGAACAAAGG + Intronic
972818781 4:42675414-42675436 CAGTGGCTCTGAGAGATCAATGG - Intergenic
973362346 4:49177266-49177288 CAGCTGCTCTGAGAGGTCAAAGG + Intergenic
973398753 4:49619595-49619617 CAGCTGCTCTGAGAGGTCAAAGG - Intergenic
973767076 4:54172542-54172564 CATCAGCTCTGAGGAATTAAGGG + Intronic
974604288 4:64130351-64130373 CAGCTACTCTGAAGCATCCATGG - Intergenic
976569969 4:86595759-86595781 CACCTGATCTGTGGGATGAAGGG + Intronic
978505568 4:109452971-109452993 CAGCTGGTCTGAGAAATAAAGGG + Intronic
980692772 4:136317522-136317544 CAGCTGCTATGAGAGATCAATGG - Intergenic
981200849 4:141978052-141978074 CAGGCACTCTGAGAGATCAATGG - Intergenic
981233423 4:142386927-142386949 CAGCTGCTCTGAGAGATCAATGG - Intronic
981436952 4:144735447-144735469 CATCTGCTCAGAGAGAGCAAAGG + Intronic
982587311 4:157258789-157258811 CGGCTGCTCTGAGAAATAAAGGG - Intronic
983423694 4:167554427-167554449 GAGCTGCTCTTAGGTATGAAAGG - Intergenic
985354912 4:189108503-189108525 CAGCTACTCTGAGAGATCAATGG - Intergenic
985354921 4:189108571-189108593 CAGCTACTCTGAGAGATCAATGG - Intergenic
985354933 4:189108639-189108661 CAGCTACTCCAAGAGATCAATGG - Intergenic
1202759685 4_GL000008v2_random:98739-98761 CAGCTGCTCTGAGAGGTCAAAGG + Intergenic
987291539 5:16512966-16512988 CAGTTGCTGCGAGAGATCAATGG - Intronic
987516299 5:18914986-18915008 CAGTTGCTCTGAGGAACAAAAGG - Intergenic
988984843 5:36607387-36607409 CAGCTGTTCTGAAAAATCAAGGG - Intronic
989337220 5:40331872-40331894 CAGCTGCTCTGAGAGATCAATGG + Intergenic
990104379 5:52238621-52238643 CAGCTGCTCTGAGGAGTTTAGGG + Intergenic
991414603 5:66379431-66379453 CAGCCACTCTGGGGGATGAAGGG - Intergenic
991953045 5:71965404-71965426 AAGCTCCTCTGGGGTATCAATGG + Intergenic
993248408 5:85483073-85483095 CAGCTGCTCTGAGAGATCAAGGG - Intergenic
993367190 5:87048804-87048826 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
993745713 5:91594317-91594339 CAGTTACTCTGAGAAATCAAAGG + Intergenic
994687752 5:102977110-102977132 CAGTTGACCTGAGGGTTCAAAGG + Intronic
995324967 5:110880128-110880150 CAGCTGCTCTGGGAGAGAAAGGG - Intergenic
997244776 5:132338131-132338153 CAGCTGGTCTGAGAAATAAAGGG + Intronic
997355311 5:133259017-133259039 CTGCTGGACTGAGGGAGCAAGGG + Intronic
997640090 5:135443342-135443364 TTGCTTCTCTGAGGGATCAGGGG - Intergenic
1002023491 5:176381298-176381320 CAGTTGCTGTGAGGGGTCAGTGG + Exonic
1002171171 5:177375345-177375367 CAGCTACTGTTAGGGACCAATGG + Intergenic
1002421645 5:179152226-179152248 CAGCTGCTTGCAGGGGTCAAAGG + Exonic
1002904550 6:1438151-1438173 CAGGTGCCCTGAGAAATCAAAGG - Intergenic
1002957568 6:1882217-1882239 CTCCAGCTCTGAGGGACCAAGGG - Intronic
1003563454 6:7202742-7202764 CAGCTGCCCTGAGGTATCTAAGG + Intronic
1004802203 6:19161540-19161562 GAAATGCTCTGAGGGCTCAAAGG - Intergenic
1005816767 6:29559426-29559448 TAGCTACTCTTAGGGATAAATGG - Intronic
1007519095 6:42437834-42437856 CAGTTGTTCTGAGGGTTAAAGGG + Intronic
1009215013 6:60911170-60911192 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1010491773 6:76485439-76485461 CGGCTGGTCTGAGGAATAAAGGG + Intergenic
1012553910 6:100489607-100489629 CACCTGCTCTGAGGGCTTGAGGG + Intergenic
1013680508 6:112520547-112520569 CAGTTGCTCTGAGGGAGCAATGG + Intergenic
1014111451 6:117622600-117622622 CAGCTGCTCTGAGAGATTAATGG - Intergenic
1014163358 6:118195834-118195856 CAGCTGCTCTGAGAGATCAGCGG + Intronic
1014469561 6:121798201-121798223 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1015325339 6:131917967-131917989 CAGCTGGTTAGAGGCATCAAAGG - Intergenic
1016854299 6:148651165-148651187 CAGCTGCTGTGAGAGATCAGTGG - Intergenic
1018062883 6:160104339-160104361 CAGCTGCGCTGGGGGATCACTGG + Intronic
1018195697 6:161354632-161354654 CAGCTTCTCTGAGGGAGGAAGGG + Intronic
1019435448 7:1020100-1020122 CTGCTGCTCTGCGGGAACACGGG + Intronic
1019698283 7:2460122-2460144 CGGCTGCTGTGAGGAATCACTGG - Intergenic
1020015694 7:4830208-4830230 CAGCTGCACTGAGAGAGCAGTGG + Intronic
1020477028 7:8608252-8608274 CAGCTGTTCTCAGGGATAAATGG + Intronic
1020603635 7:10307494-10307516 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1020646801 7:10824581-10824603 CAGCCACTCTGAGAGATCAAGGG - Intergenic
1020847850 7:13310301-13310323 CCACTGCTCTGAGAGATCAAAGG - Intergenic
1021898018 7:25255931-25255953 CAGCTGCACAGTGGGATCAGAGG + Intergenic
1022746133 7:33174230-33174252 CAGTTGCTGTGAGAGAGCAATGG + Intronic
1024213130 7:47224035-47224057 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1025155201 7:56598992-56599014 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1025292422 7:57742432-57742454 CAGCCACTTTGAGAGATCAAGGG - Intergenic
1026253132 7:68688300-68688322 CAGCTGCTCTGAGGAAATATCGG - Intergenic
1026792957 7:73346611-73346633 GAGCTGCTCTGAGGGGCTAAAGG + Intronic
1026920508 7:74152154-74152176 CAGCTTCTTGGAGGGTTCAAGGG - Intergenic
1027960648 7:84941301-84941323 CATCAGCTCTGAGAGATCAATGG - Intergenic
1029276290 7:99406798-99406820 CAGCTGCTGTAAGGAATCAGAGG - Intronic
1032711435 7:134463685-134463707 CAGCTGCTCTGTGGGCCCAGTGG - Intergenic
1033277795 7:139985797-139985819 CAGGTGCCCTGAGGAATGAATGG + Intronic
1034929688 7:155151934-155151956 CAGCTGTTCTGAGACATAAAGGG - Intergenic
1035362117 7:158320463-158320485 CAGCTGCTCGGAGTGAAAAATGG - Intronic
1036168730 8:6462656-6462678 CACCTGCTCTGTGGGTTCCATGG + Intronic
1036664753 8:10730955-10730977 CGGCTGCTCTGAGGGGTTCATGG - Intronic
1038875413 8:31543151-31543173 TTGCTGGTCTGAGGGAGCAACGG - Intergenic
1038991941 8:32877750-32877772 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1040139442 8:43893545-43893567 CAGCTGATCTGAGAAATAAAGGG - Intergenic
1040140076 8:43899285-43899307 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1041605185 8:59773743-59773765 CAGTTGCTCTGAGAAATCAAAGG + Intergenic
1042158855 8:65871774-65871796 CAGCTGCCCCGAGAGAGCAATGG - Intergenic
1043826546 8:84936411-84936433 CAGCTGCTCCGACAGATCAATGG - Intergenic
1044032977 8:87261272-87261294 CAGCTGCTCTGAGAGATCAATGG + Intronic
1044590299 8:93907879-93907901 CAGCTGGTCTGAGAAATAAAGGG + Intronic
1045986623 8:108256702-108256724 CTGCTGCACTGAGGGATCAGAGG + Intronic
1046202931 8:110950931-110950953 CAGTCACTCTGAGAGATCAAGGG + Intergenic
1046578850 8:116067088-116067110 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1047901586 8:129428595-129428617 AAGCTGTTCTGAGTGATCATTGG - Intergenic
1048507868 8:135036755-135036777 CAGCAGCTCTGAGTGACCAAGGG + Intergenic
1050657658 9:7847028-7847050 CAGCTGCTCTGAGAGATCAATGG - Intronic
1051770972 9:20579255-20579277 CAGCTACTCTGGAGGCTCAATGG + Intronic
1052083758 9:24238917-24238939 CAGCTGGTCTGAGAAATAAAAGG + Intergenic
1052646455 9:31241556-31241578 CAGTTGATGTGAGAGATCAATGG + Intergenic
1052823481 9:33158380-33158402 TAGCTGGACTGAGGGATCAAAGG - Intronic
1054164087 9:61703280-61703302 CAGCCACTTTGAGAGATCAAGGG + Intergenic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1057701110 9:97363800-97363822 CAGCTGCTGTGAGAGGGCAAGGG - Intronic
1057780467 9:98045808-98045830 CAGCTGCTCCAAGAGATCAATGG - Intergenic
1058288750 9:103211287-103211309 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1058530468 9:105900951-105900973 CAGCTTCCCAGAGGGTTCAAGGG + Intergenic
1058731853 9:107857986-107858008 CAGCTGCTGTGAGAGAGCGATGG + Intergenic
1059285709 9:113169748-113169770 CACCTGCTCTGAGGGCACCATGG + Exonic
1059465964 9:114469073-114469095 GGGCTGCTGTGAGGGATGAATGG + Intronic
1059637691 9:116187018-116187040 CAACTGCTCTGTGGGATCCTAGG - Intronic
1059756667 9:117300254-117300276 CTGCTGCTTAGAGGGAACAAAGG - Intronic
1061022429 9:128024966-128024988 GAGCTGGTCTGAGTGACCAACGG - Intergenic
1061152237 9:128835510-128835532 TAGCTGCCCTGAGGGATGATGGG + Exonic
1062706155 9:137944606-137944628 CATCTCCCCTGAGAGATCAAAGG + Intronic
1203691472 Un_GL000214v1:46954-46976 CAGCAGCTCTGAGAGATCAAAGG + Intergenic
1203751915 Un_GL000218v1:87845-87867 CAGCTGCTCCGAGAGATCAAAGG - Intergenic
1203710595 Un_KI270742v1:93820-93842 CAGATGCTCTGAGAGGTCAAAGG - Intergenic
1203540461 Un_KI270743v1:83634-83656 CAGCTGCTCTGAGAGGTCAAAGG + Intergenic
1203644823 Un_KI270751v1:57237-57259 CAGCAGCTCTGAGAGATCAAAGG - Intergenic
1188073305 X:25744584-25744606 CAGCTGCTCTGAGAGATCAATGG + Intergenic
1188340722 X:28997999-28998021 CAGCTGCACTGAGGGAAAAGGGG - Intronic
1188823616 X:34803363-34803385 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1189116948 X:38352581-38352603 CAGTTGCAGTGAGGGAGCAAAGG - Exonic
1190137177 X:47807693-47807715 CAGCTGCTCTGAGCCTCCAAGGG - Intergenic
1191157669 X:57293034-57293056 CAGCAGCTCTGAGGTATTAGAGG + Intronic
1191638066 X:63399790-63399812 CAGCTGCTCCAAGAGAACAATGG + Intergenic
1191898126 X:66015070-66015092 CAGAGCCTCTGAGGGATAAAAGG - Intergenic
1192078569 X:68024952-68024974 CAGTTGCAGTGAGGGAGCAAGGG - Intergenic
1193959095 X:87901385-87901407 CATTTGCTCTGAGAGACCAATGG + Intergenic
1193979583 X:88165410-88165432 CAGCTGCTTTGAGACATCAATGG - Intergenic
1194052059 X:89081101-89081123 CAGCTGCTCCAAGAGATCAATGG + Intergenic
1194828517 X:98593041-98593063 CAGCTGCTTCAAGAGATCAATGG + Intergenic
1195495338 X:105525252-105525274 CAGCTGCTATGAAGGATCAAAGG + Intronic
1196279944 X:113812388-113812410 CAGCTGGTCTGAGGGACCCCAGG + Intergenic
1196814610 X:119654827-119654849 CAGTGGCTCGGAGGGATCAAAGG - Intronic
1198498103 X:137214194-137214216 CAGCATCTCTGAGAGATCAATGG - Intergenic
1199536405 X:148907460-148907482 CAGCTGGTCTGAGACATAAAGGG + Intronic
1199609932 X:149604557-149604579 GTGCTGCTAGGAGGGATCAATGG - Intronic
1199884250 X:152003310-152003332 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1200395285 X:155982794-155982816 CCCCTGCTCTAAGGGATCCATGG + Intergenic
1200462233 Y:3471732-3471754 CAGCTTCTCTGAGAGAGCAATGG - Intergenic
1200928874 Y:8679127-8679149 CATCTTCTCTGTGGGATCCATGG - Intergenic