ID: 1154365352

View in Genome Browser
Species Human (GRCh38)
Location 18:13703017-13703039
Sequence TGGGACCCCTTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 14, 2: 21, 3: 32, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154365352 Original CRISPR TGGGACCCCTTGGGAAAAAC AGG Intronic
901355869 1:8648241-8648263 TGAGACCCCATCGCAAAAACAGG - Intronic
903262532 1:22139137-22139159 TGGGACAGCCTGGGATAAACAGG + Intronic
905033402 1:34902450-34902472 TGGTACCCAGTGGGAGAAACAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
910726802 1:90348457-90348479 TGAGACCCCTTGTGAAGAAAGGG + Intergenic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
911315617 1:96353184-96353206 TGAGACCCCCTGGAAAAGACAGG - Intergenic
912749554 1:112274884-112274906 TGGGTCCTCTTGGGAGATACAGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918937765 1:190945894-190945916 TGAGAACCCTTGTGAAAATCAGG + Intergenic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920099430 1:203507749-203507771 TGGGTAACCTTTGGAAAAACAGG - Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921705637 1:218319598-218319620 TCAGACCCCTTTGGAGAAACAGG - Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1073103082 10:101017019-101017041 TGGGTCCCCAGGGGAAAATCAGG - Intronic
1075741744 10:124700232-124700254 TGGGAAGCCTGGGGAAAAAAAGG - Intronic
1077211416 11:1372440-1372462 TGGGACCCCGTGTGAAATCCTGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1079002199 11:16767379-16767401 GGGGACCCCTTGGTCAAAAGGGG + Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081981301 11:47268991-47269013 TGGGGCCCTGTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083969261 11:66063426-66063448 TCGGACCCCTTGGGGGGAACTGG + Exonic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1092173423 12:6387550-6387572 TGGGAGGCCTGGGGAGAAACTGG - Intronic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1100381013 12:94061913-94061935 TTGGAACCCTTGGGCAAAGCTGG + Intergenic
1100930931 12:99608752-99608774 TGAGACCCCTTGAAAAACACAGG - Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1103180408 12:118906401-118906423 TGTTACACCTTGGGAAACACTGG - Intergenic
1103635583 12:122302472-122302494 GGGGACCCATTGGGAAAAATTGG - Intronic
1103833520 12:123799897-123799919 TGGGACCCCTAGGGAACAGGTGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107864925 13:44694261-44694283 TGTGACCCCATGGCAAACACAGG - Intergenic
1108708003 13:53007289-53007311 TGGGACACCTTGGGAGGCACAGG - Intergenic
1113968685 13:114171386-114171408 TGGGACTCTTTAAGAAAAACAGG - Intergenic
1114257373 14:21014877-21014899 TGTGACCCCATGGGCTAAACTGG + Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1118849694 14:69574094-69574116 TGGGGTCCCTTGGGATGAACAGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119814635 14:77554933-77554955 TGGGAGCCCATGGGAATAGCAGG - Intronic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1124201713 15:27684206-27684228 TGCTAGCACTTGGGAAAAACAGG - Intergenic
1124595153 15:31086166-31086188 TGGGACCACTGGGGAACACCTGG + Intronic
1125132683 15:36302403-36302425 TGGGAGCCCCTGGGCAAACCTGG - Intergenic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1126788084 15:52195533-52195555 TGGGAACCATTGGGAAGCACAGG + Intronic
1127849859 15:62902926-62902948 TGGGCCCTTGTGGGAAAAACGGG + Intergenic
1131249165 15:90819508-90819530 TGGGACCCATGGGGACAGACAGG - Intergenic
1134387982 16:13792146-13792168 TGGGACCAGTGGGGAAACACGGG - Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1136692855 16:32048589-32048611 AGGGAACACCTGGGAAAAACAGG - Intergenic
1136793350 16:32991814-32991836 AGGGAACACCTGGGAAAAACAGG - Intergenic
1136876503 16:33862242-33862264 AGGGAACACCTGGGAAAAACAGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138851267 16:60632636-60632658 TCAGACCCCTTGAGAAACACAGG - Intergenic
1142243188 16:88956375-88956397 TGAGACCCCTGGGGAAGAGCAGG - Intronic
1203095610 16_KI270728v1_random:1253505-1253527 AGGGAACACCTGGGAAAAACAGG - Intergenic
1142967486 17:3590544-3590566 TGGGACCCCTTGGGGGACCCTGG - Intronic
1143121204 17:4608113-4608135 TGGGGCCTCCTGGGAAGAACAGG - Exonic
1145018228 17:19412481-19412503 TGGGACCTGTGGGGCAAAACAGG - Exonic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146315361 17:31802688-31802710 TGGGAGCCCCAGGGAGAAACAGG - Intergenic
1146372036 17:32270682-32270704 TGGGACCCATGGGGAAGAATCGG - Intronic
1146663603 17:34681902-34681924 TGGGACCCCAAGTGAAAAAGGGG + Intergenic
1148525672 17:48330803-48330825 TCCGCCCCCTGGGGAAAAACTGG - Intronic
1149472655 17:56931272-56931294 TAGGAACCCCTTGGAAAAACTGG + Intergenic
1150099095 17:62406230-62406252 TGGGAAGCCTTGGGGAAAAAAGG + Intronic
1150824566 17:68463203-68463225 GGGGACACCTCAGGAAAAACTGG + Intergenic
1152045728 17:77934153-77934175 TGGGAAGCTTTGGGAAAGACTGG - Intergenic
1152792756 17:82290976-82290998 TGGGACCCCTTGGCCAAGAGGGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155072677 18:22329980-22330002 TGGGTCTCCGTGGGAAACACAGG + Intergenic
1155495219 18:26436048-26436070 TGAGAGCCCTTAGGAAAAAGAGG - Intergenic
1159509407 18:69377231-69377253 TTGGAGCCCTTGAGAGAAACAGG + Intergenic
1160507619 18:79436295-79436317 TGGGAGCCGTTGGGAACAACTGG + Intronic
1161520833 19:4722870-4722892 TGGGGCCCCTGGGGAAGACCAGG + Intronic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1164668793 19:30061520-30061542 TGGGCCACCTTGGGAAGACCAGG - Intergenic
1165393003 19:35549075-35549097 TATGTTCCCTTGGGAAAAACAGG - Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166426421 19:42682885-42682907 TGGGACCACTTAGGAAAAACAGG - Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167000892 19:46745580-46745602 TGGGACCCGCTGGGAAAGAGCGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG + Intergenic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
930065345 2:47323621-47323643 TGGCACCCCTTGGCAAAACAAGG + Intergenic
930899333 2:56484558-56484580 TGGGGTCCCCCGGGAAAAACTGG - Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942887484 2:180944511-180944533 GGGGACCACTTTGGAAAAAGTGG + Intergenic
943726474 2:191256545-191256567 AGGGACCCCTTTGGAAAATATGG + Intronic
943984443 2:194602301-194602323 GGGGTCCCCTTGGGCAAAATGGG + Intergenic
944377620 2:199065536-199065558 TGTGTCCCTTTGGGAAAAAAAGG - Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
944899353 2:204198509-204198531 TGGCATCCCTTGGGGAAAAGGGG - Intergenic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
947393256 2:229661805-229661827 AGTGACCCCTTTGAAAAAACTGG + Intronic
947574121 2:231258879-231258901 TGGGAGCCCATGGGAACAGCAGG + Intronic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
948620274 2:239230223-239230245 TGGGACCCCTTGGTCAAGAAGGG + Intronic
1171124017 20:22586386-22586408 TGGGACCCCGTGGGAAATGCTGG - Intergenic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1173820917 20:46019934-46019956 TGGTACCCCTTGGGGAGAAGAGG - Intergenic
1173866100 20:46313526-46313548 TGGGGCCAGGTGGGAAAAACAGG + Intergenic
1174299266 20:49569598-49569620 TGGGACCTCTAGGGAAAGATGGG - Intergenic
1174780621 20:53385645-53385667 TGGGAACCCTGGGTTAAAACTGG - Intronic
1176037534 20:63047163-63047185 TATGACCCACTGGGAAAAACTGG - Intergenic
1176064948 20:63189419-63189441 TGGGAGCCCTGGGCAAGAACAGG - Intergenic
1178244706 21:30939158-30939180 TGGGAGACTTTGGAAAAAACTGG + Intergenic
1181025434 22:20124815-20124837 TGGGTTCCCTTAGGAAAGACTGG + Intronic
1183472601 22:38017454-38017476 TGGGAGCCCTTGGCAGAACCAGG - Intronic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
949242818 3:1891659-1891681 TGGCACCCCTTGGGGAACTCTGG - Intergenic
949562921 3:5219433-5219455 AGGGACCCCTTGGGAAATCGAGG + Exonic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950919114 3:16676339-16676361 TAAAACCCCTTTGGAAAAACTGG + Intergenic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
953617885 3:44508332-44508354 TGGGGCCCTATGGGAAGAACTGG - Intronic
955486575 3:59440063-59440085 TTGAGCCCCTTGGGAAGAACAGG + Intergenic
956839508 3:73124646-73124668 TGGGACCCCCTAAGGAAAACTGG - Intergenic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962908313 3:139825225-139825247 TGGGAAGCCTTGGGAAGAATTGG + Intergenic
963924637 3:150938520-150938542 TGTGACCTCTGGGGATAAACAGG - Intronic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968545809 4:1197409-1197431 AGGTAGCCCTTGGGTAAAACAGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
976600742 4:86935394-86935416 TGGGAGCCCTCGGGGAGAACGGG + Intronic
976955717 4:90896672-90896694 TGGGAGCACTGGTGAAAAACTGG + Intronic
976984529 4:91276747-91276769 TTGGACACAATGGGAAAAACTGG - Intronic
977752203 4:100622629-100622651 TGGGACACAATTGGAAAAACTGG - Intronic
980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
987144958 5:14982911-14982933 TGGGACCCCTTGGCCAAGAGAGG - Intergenic
988157611 5:27475625-27475647 TGGGAACCCCTTGGGAAAACTGG + Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
989667764 5:43875982-43876004 TGGCTCCTCTTGGGAAACACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
997457744 5:134029955-134029977 TGTAACCCCTTGGGAAAACTGGG + Intergenic
1000191772 5:158917944-158917966 TGGGTCCCTTTGGGAAGAAAGGG + Intronic
1001324347 5:170710703-170710725 TGGAATCCCTTGAGAACAACTGG - Intronic
1005805307 6:29468670-29468692 TGGCAGCCCTTGGGAATCACAGG - Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010653623 6:78484777-78484799 TGTGACCACTTGGAAAAAAATGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1012282521 6:97345577-97345599 AGGCACCACCTGGGAAAAACAGG - Intergenic
1012330941 6:97986236-97986258 TGGTAACCATTGGGAGAAACTGG + Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016911486 6:149203319-149203341 TGGAACCCCAGGAGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018801911 6:167229470-167229492 TGGTACTCCTTGAAAAAAACAGG + Intergenic
1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG + Intergenic
1020052756 7:5092911-5092933 AGGGGACCCTTGGCAAAAACTGG + Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029596212 7:101538776-101538798 TGGGATCCCTGGGGACAAAGTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030541474 7:110835884-110835906 AGTGACCCATTGGGAAAAATGGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031360351 7:120842391-120842413 TGGAACCTCTTGGGGAACACAGG + Intronic
1036142239 8:6219073-6219095 TGGGTCCCTTTGGGGAAGACTGG - Intergenic
1036754941 8:11465892-11465914 TGGGACCTCCTGGGAAGATCTGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039910213 8:41820569-41820591 TGGGACCCCTGAGAAAACACTGG - Intronic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044125937 8:88457791-88457813 TGGGACCCATGGGAAATAACTGG - Intergenic
1045956856 8:107918367-107918389 TGGGACACCATTGGAGAAACTGG + Intronic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG + Exonic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052089359 9:24308859-24308881 TGGGACCTGTTGGGGAAAGCGGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059225718 9:112671123-112671145 TGGGATCCCCTGAGAAATACAGG - Intergenic
1062363729 9:136199207-136199229 TGGGAGCGATTGGCAAAAACGGG + Intronic
1062694705 9:137867488-137867510 AGGGTCCCCTGGGGAAAATCTGG - Intronic
1185482885 X:460703-460725 TGGGAGCCGTTGGGTAAAGCGGG + Intergenic
1186340783 X:8644256-8644278 TGGGACCCCTTGGCTAAGATGGG - Intronic
1190540807 X:51476098-51476120 TAAAGCCCCTTGGGAAAAACTGG - Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192077911 X:68018713-68018735 TGGGAGCCCTTGGGACTAAAGGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG + Intergenic
1195842220 X:109186630-109186652 TGAGACCCCTTGAGGAACACAGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1199076808 X:143534686-143534708 TGGGACAACTTGGGAGAAAAGGG - Intergenic
1199679627 X:150215832-150215854 TGGGAGCCTGTGGGAAAGACAGG - Intergenic
1199695604 X:150341217-150341239 TGGGAGCCTGTGGGAAAGACAGG + Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic