ID: 1154365426

View in Genome Browser
Species Human (GRCh38)
Location 18:13703539-13703561
Sequence GTTTCTAGTGCCTAACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 2, 2: 25, 3: 88, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154365426 Original CRISPR GTTTCTAGTGCCTAACAAGC AGG (reversed) Intronic
902993575 1:20206454-20206476 GTTTATAGTGTTTAACAAGTAGG + Intergenic
904709470 1:32417961-32417983 ATTTCTAGGGCATAATAAGCAGG - Intergenic
905981177 1:42229655-42229677 GTTTGTAGTTCCTACCTAGCAGG - Intronic
906331670 1:44890223-44890245 GTTTCTGGGGCCTAATAAGCAGG - Intronic
908733426 1:67250875-67250897 GTTTCTGGGGTCTAATAAGCAGG + Intronic
908905069 1:68998886-68998908 GTTTCTAGTGACTAACAGGGTGG - Intergenic
911134180 1:94421630-94421652 GTTTCTTTTCCCTAACAAGAAGG - Intronic
911625944 1:100124719-100124741 GTTTCTAGTGCCAAAAAGGTTGG - Intronic
912093982 1:106116483-106116505 GTTTCTAGAGCCTAATCAACAGG - Intergenic
916036076 1:160923645-160923667 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
916954584 1:169819060-169819082 GTTTCTACAGCCTAATAAGCAGG + Intronic
917556687 1:176097377-176097399 GCTTCTAAGGCCTAACAAACAGG - Intronic
920043183 1:203117072-203117094 GTCTCTAGTGCCAAAAAATCTGG - Intronic
920219096 1:204382921-204382943 GTTTCTAGTGACTCACAAATAGG + Intergenic
921535753 1:216346736-216346758 ATTTCTAAAGCCTAATAAGCAGG - Intronic
922664819 1:227459750-227459772 CTTTATAGTGCTTAACAAGATGG - Intergenic
1063306896 10:4910791-4910813 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1063332403 10:5174111-5174133 GTTTCTAGGGCCTAATAAATAGG - Intergenic
1067463949 10:46479997-46480019 GTTTCTAGGACCTAATAAGGAGG - Intergenic
1067623246 10:47904654-47904676 GTTTCTAGGACCTAATAAGGAGG + Intergenic
1067822997 10:49547358-49547380 ATTTCTAGGGCCTAATAAGCAGG + Intergenic
1067836866 10:49646798-49646820 GTTTCTGCTGCCTAAGAGGCTGG + Intronic
1068348771 10:55817138-55817160 GTTTCTAGGGACTGATAAGCAGG + Intergenic
1068479849 10:57576909-57576931 ATTTCTAGGGCATAATAAGCAGG + Intergenic
1068907449 10:62343157-62343179 ATTTCTAGGGCCTAATAAGCAGG + Intergenic
1074484717 10:113864213-113864235 GTTGCTAGTGACTAGCAAGAGGG + Intronic
1077926850 11:6689743-6689765 GTTTCTAGGGCCTAACAAGCAGG - Intergenic
1083011361 11:59403089-59403111 ATTTCTAGGGCCTAATAAGCAGG - Intergenic
1083026271 11:59553754-59553776 GTGTTTGGTGCCTATCAAGCTGG + Intergenic
1084875344 11:72128108-72128130 GTTTCCAGGGCCTAATAAACAGG + Intronic
1084878547 11:72152809-72152831 GTTTCTACAGCCTAATAAGCAGG + Intergenic
1090455626 11:126846241-126846263 GTTTCTAGGGCCTAATAAGCAGG - Intronic
1092653290 12:10657205-10657227 ATTTCTAGAGCCTAATAGGCAGG - Intronic
1093222893 12:16445319-16445341 GTGTCTAGTGCCTAACATAAGGG - Intronic
1093920912 12:24858086-24858108 GTTTCTGGGGCCTAATAAACAGG - Intronic
1097601341 12:61696230-61696252 GTTTCTAGCGCCTAATAAACAGG - Intergenic
1101383779 12:104237527-104237549 TTTTTTAGGGCCTAATAAGCAGG - Intronic
1103784642 12:123423080-123423102 GTTACTAGTGCCAAAAATGCTGG - Exonic
1105425025 13:20286527-20286549 GTTTCTATGGCCTAATAAGCAGG - Intergenic
1109469611 13:62788609-62788631 GTATCTAGAGCCTAATAAGCAGG + Intergenic
1109609179 13:64740694-64740716 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1110735775 13:78934793-78934815 GTATCTATTGACTTACAAGCTGG - Intergenic
1113524229 13:110961554-110961576 GTTTCTACAGCCTAATAAGCAGG - Intergenic
1113700733 13:112385977-112385999 ACTTCTAGGGCCTAATAAGCAGG + Intronic
1113858666 13:113466173-113466195 TTTTCTAGAAACTAACAAGCAGG - Intronic
1116103216 14:40467138-40467160 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1116235377 14:42272855-42272877 GTTTCTAGGGACTAATAAACAGG + Intergenic
1116483662 14:45420704-45420726 GTTTTTATGGCCTAATAAGCAGG - Intergenic
1116514649 14:45790077-45790099 GTTTCTAGGGCCTAATAAATAGG - Intergenic
1118537880 14:66789558-66789580 GTTTCTATGGCCTAATAACCAGG + Intronic
1118952136 14:70444708-70444730 GTTTCTAGGGCCTAAAAAACAGG + Intergenic
1119305495 14:73604859-73604881 GTTTCTAAGGTCTAATAAGCAGG + Intergenic
1121003862 14:90473843-90473865 GTTTCTATGGCCTAATAAGCAGG - Intergenic
1121610947 14:95278907-95278929 GTTTTTAGGGCCTAATAAGCGGG - Intronic
1122591946 14:102859875-102859897 GTTTCTATGGCCTAATAAGCAGG + Intronic
1123477930 15:20604273-20604295 ATTTCTAGGGCCTAATAAGCAGG - Intergenic
1123640084 15:22396110-22396132 ATTTCTAGGGCCTAATAAGCAGG + Intergenic
1123865521 15:24515909-24515931 GTTTCTAGGGCCTAGTAAGCAGG + Intergenic
1125062276 15:35438501-35438523 GTTTCTAGGACCTAATAAACAGG - Intronic
1126214945 15:46143989-46144011 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1126288689 15:47046227-47046249 GTTTATAGGGACTAATAAGCAGG + Intergenic
1126623862 15:50667223-50667245 GTTTCTAGGGCCTAGTAATCAGG - Intronic
1128833302 15:70788869-70788891 CTATCTAGTGACTAACGAGCAGG - Intergenic
1129527723 15:76232075-76232097 GTTTCCAGAGCCTAACAAAAAGG + Intronic
1132784766 16:1650088-1650110 GTGTTTAGGGCCAAACAAGCCGG - Intronic
1135144955 16:19953259-19953281 GTTTCTAAGGCCTAATAGGCAGG - Intergenic
1137452799 16:48592403-48592425 GTTACTAGGGCCTAAAAAGCAGG - Intronic
1139105958 16:63826571-63826593 GTTTCTAGGTCCTAACAGGCAGG - Intergenic
1139205074 16:65020918-65020940 ATTTCTAGGGCTTAATAAGCAGG + Intronic
1140881285 16:79200199-79200221 ATTTCTAGTGCCTAAAACCCTGG - Intronic
1142549507 17:729753-729775 GTTTCTAGGACCTAACAGTCTGG + Intergenic
1144228083 17:13171324-13171346 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1144555487 17:16279045-16279067 GTTTCTAGGGCATCATAAGCAGG + Intronic
1150183279 17:63150592-63150614 GCTTCTAGTGTCAAACTAGCAGG + Intronic
1150348450 17:64422877-64422899 GTTTCTAGGGACTAATAAGCAGG - Intergenic
1151442290 17:74138055-74138077 GTCTCTAGTGCCAAAAAGGCTGG - Intergenic
1152011618 17:77722406-77722428 TTTCCTAGTGGCTAACAGGCTGG - Intergenic
1153148405 18:2059452-2059474 GTTTCTCGTGCATAACAATGGGG - Intergenic
1154365426 18:13703539-13703561 GTTTCTAGTGCCTAACAAGCAGG - Intronic
1159309570 18:66689194-66689216 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1159431552 18:68358968-68358990 CTTTCTAGGGCCTAATAAACAGG - Intergenic
1165261303 19:34621318-34621340 GTTTCTAGGGCCTAATAAACAGG + Intronic
1166900843 19:46061549-46061571 GTTTCTACAGCCTAACAAGCAGG + Intronic
1168582064 19:57563720-57563742 GTTTCTGGGGCCTAATAAACAGG + Intergenic
925471914 2:4172277-4172299 ATTTTTAGGGCCTAATAAGCAGG + Intergenic
925892955 2:8450845-8450867 GTCTCTAGTGCCAAAGAAGACGG - Intergenic
927927683 2:27024962-27024984 GCTTCTAGTGCAAAGCAAGCAGG - Intronic
928672374 2:33614578-33614600 GTTTCTAGGACCTAATAAGCAGG - Intergenic
930498308 2:52176803-52176825 GTTTCTAAAGCCTAATAAGCAGG - Intergenic
931129045 2:59312616-59312638 GTTCCTAGTGCCTAAAAAACTGG - Intergenic
935708471 2:105876962-105876984 GTTTCTGCTGCAGAACAAGCAGG - Intronic
935885894 2:107618562-107618584 GTTTCTATGGCCTAATAAGTAGG - Intergenic
936033908 2:109094376-109094398 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
936376970 2:111948970-111948992 GTGACTCGTGCCTAACAAGCAGG - Intronic
938338868 2:130522633-130522655 GTTTCACATCCCTAACAAGCAGG + Intronic
938350970 2:130598117-130598139 GTTTCACATCCCTAACAAGCAGG - Intronic
939054257 2:137344235-137344257 GTCTCTAGTGCCAAAAAAGTTGG + Intronic
940499166 2:154473456-154473478 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
941639617 2:167972945-167972967 GTTTCTAGGGCCTAATAAGCAGG - Intronic
941877701 2:170451807-170451829 GTTTTCAGGGCCTAATAAGCAGG + Intronic
942096563 2:172539966-172539988 GTTTCTAGGGCCTAATAAGTAGG - Intergenic
942171652 2:173295643-173295665 GTTTTTAGGGCCTAATAAACAGG + Intergenic
942620322 2:177838210-177838232 TTTTCTAGGGCCTAACAAACAGG - Intronic
943985049 2:194607364-194607386 ATTTTTAGGGCCTAATAAGCAGG - Intergenic
944519902 2:200555375-200555397 CTTTCTAGGGCCTAATAAGCAGG + Intronic
944647672 2:201795778-201795800 GTTGCTAGGGCCAGACAAGCCGG - Intronic
1170927499 20:20738766-20738788 GCTTCTAGGGCCTAATAAGAAGG - Intergenic
1171319028 20:24222618-24222640 GTTCCTAGGGCCTAATAAGCAGG + Intergenic
1173264111 20:41462083-41462105 GTTTCTAGTGCCTACTCAGTGGG + Intronic
1176693592 21:9947762-9947784 GTTTCTAGGGCCTAATAAACAGG + Intergenic
1177414774 21:20779824-20779846 GTTTCTATTGCCTAATAAATAGG + Intergenic
1178355717 21:31909291-31909313 GTTTCTAGTCTCTCACCAGCAGG + Intronic
1182402812 22:30095003-30095025 GTTTCTAGGGCCTAATAAACAGG - Intronic
1183325780 22:37192908-37192930 GTTTCTAAGGCCTAATAAGCAGG + Intronic
1184418979 22:44368700-44368722 GGTTCTAGTGCCTATGACGCTGG - Intergenic
949998502 3:9638140-9638162 GTTTCTAGGACCTAATAAGCAGG + Intergenic
951256071 3:20451374-20451396 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
952294780 3:32051643-32051665 GTTTCTAGGACCTAGTAAGCAGG - Intronic
953153682 3:40348275-40348297 GTTTCTAGGGCCCAATTAGCAGG - Intergenic
953176582 3:40559039-40559061 GTTTCTAGGGCCTAATAAACAGG + Intronic
953647864 3:44772240-44772262 GTTTCTAGGGCCTAGTAAACAGG + Intronic
953820732 3:46205542-46205564 GATTCAAGTGCCAAAAAAGCAGG - Intronic
954484525 3:50835663-50835685 GTTTTTAGGGCCTAATAAGCAGG + Intronic
959872854 3:111348919-111348941 GTTTCTACAGCCTAATAAGCAGG + Intronic
961595832 3:128015510-128015532 ATTTCTAGAGCCTAATAAGCAGG - Intergenic
962045380 3:131753997-131754019 GTTTTTAGTGCCAAATAAACTGG + Intronic
963174549 3:142284039-142284061 ATTTTTAGGGCCTAATAAGCAGG - Intergenic
963251411 3:143106647-143106669 GTTTCTAGGGCATAAGAAACAGG - Intergenic
964004814 3:151814131-151814153 GTTTCTAGAGACCAAGAAGCGGG + Exonic
964331360 3:155606901-155606923 GTTTCTAGGGCATAATAAGCAGG - Intronic
964855831 3:161144276-161144298 GTTTCTAGGGCCTAACAAACAGG - Intronic
964961720 3:162436218-162436240 ATTTTTAGAGCCTAACAAGCAGG + Intergenic
964970187 3:162550952-162550974 GTTTCTAGGAACTAATAAGCAGG + Intergenic
965205613 3:165716818-165716840 GTATCTAGGGCCTAATAAGCAGG + Intergenic
965644474 3:170865623-170865645 GTTTCTGGTGCCTACAAAGCAGG + Exonic
965869232 3:173246941-173246963 GTTTCTAGGTCCTAATAAGCAGG + Intergenic
968786600 4:2626533-2626555 GTCTCTGGTGCCTGACAAGGAGG + Exonic
971968906 4:33596248-33596270 ATTTCTAGGGCCTAATAAACAGG - Intergenic
972144848 4:36010542-36010564 GTATCCAGTGCCTAAGAGGCTGG - Intronic
974028235 4:56753084-56753106 GTTTCTGGTGTCCAACAAGTAGG - Intergenic
974839538 4:67285115-67285137 GTTTCTATGGCCTTATAAGCAGG + Intergenic
974925671 4:68295194-68295216 GTTTCTAGGACCTAATAAGCAGG + Intergenic
976692313 4:87881937-87881959 GATTCTTGTGCCTGAGAAGCTGG + Intergenic
977499951 4:97825575-97825597 GTTTCTAGGGCCTAATAAGCAGG - Intronic
977527217 4:98159860-98159882 GTTTCTAGAGCCCAATAAGCAGG - Intergenic
979170331 4:117594306-117594328 GTTTCTAGAGCCTAATAAGCAGG + Intergenic
979947838 4:126856313-126856335 GTCTCTAGCACTTAACAAGCTGG + Intergenic
980321717 4:131288580-131288602 GTTTGTAGGGCCTAATAAGTAGG + Intergenic
980366213 4:131808000-131808022 GTTTCTAGGGCCTAATAAACAGG + Intergenic
980642654 4:135599512-135599534 ATTTCTAGGGCCTAATAAGCAGG - Intergenic
981714517 4:147739512-147739534 GTTTCTAGCGTCTGACATGCTGG + Intronic
981770358 4:148301055-148301077 GTTTCTAGGGCCTAATAAACAGG - Intronic
982399515 4:154951676-154951698 GTTTCTAGGGCCTAATAATCAGG + Intergenic
982606800 4:157526024-157526046 ATTTCCAGGGCCTAACAAGCAGG + Intergenic
982864278 4:160490341-160490363 GTTTCTATGGCCTAATAAGCAGG - Intergenic
983694913 4:170516217-170516239 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
986416842 5:7537503-7537525 GAATCTGGTGCCTAACAAGATGG - Intronic
988568375 5:32340013-32340035 GTTTCTATGGCCTAATAAGTAGG + Intergenic
989102855 5:37837369-37837391 ATTTCTCGTGCCTGGCAAGCTGG + Intronic
990070742 5:51780247-51780269 ATTTCTACAGCCTAATAAGCAGG + Intergenic
990692559 5:58379600-58379622 GTTTCTACAGCCTAATAAGCAGG - Intergenic
990807779 5:59685507-59685529 TTTTTCAGTGCCTAACAAACAGG - Intronic
994244584 5:97465798-97465820 GCTTCTAAGGCCTAATAAGCAGG + Intergenic
994467869 5:100162043-100162065 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
994562712 5:101396295-101396317 GTTTCTAGGGCCTAACAAGCAGG - Intergenic
995581812 5:113609934-113609956 ATTTCTAGGGTCTAATAAGCAGG - Intergenic
996057798 5:118999854-118999876 GTTCCTATGGCCTAATAAGCAGG + Intergenic
1000741167 5:164972224-164972246 GTTTTTAGGGCCCAACAAACAGG + Intergenic
1004243559 6:13951293-13951315 GTTTCTAGGGCCTAATAAGCAGG + Intronic
1005181577 6:23113224-23113246 TTTTTTAGGGCCTAATAAGCAGG - Intergenic
1006196911 6:32249479-32249501 GTTTCTATGGCCTAATAAGCAGG - Intergenic
1006570888 6:35003204-35003226 CTGTCTAGTGCCTAAGTAGCAGG - Intronic
1009348961 6:62651086-62651108 GTATCTAGGGCCTAATAAACAGG + Intergenic
1009631953 6:66211156-66211178 GTTTCCAGGGCCTAATAAACAGG - Intergenic
1009716842 6:67408584-67408606 GTTTCTAGGGTGTAATAAGCAGG - Intergenic
1009735629 6:67673304-67673326 GTTTCTAGGGCCTAATAAACAGG + Intergenic
1010104052 6:72147410-72147432 GTTTCTAGGGCCTAATAAGCAGG + Intronic
1011341634 6:86321761-86321783 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1011721004 6:90156602-90156624 GTTTCTACTACCAAACAAGTAGG + Intronic
1012201118 6:96406989-96407011 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1014097533 6:117477174-117477196 GTTTCTACAGCCTAATAAGCAGG + Intronic
1014738558 6:125122837-125122859 GTTTCTAGGGCCTAATAAGCAGG - Intronic
1015377607 6:132528171-132528193 GTTTCTAGGGCCTAATTAGCAGG - Intergenic
1015813422 6:137184283-137184305 GTTTCTAGGGCCTAATAAACAGG + Intergenic
1016108564 6:140192221-140192243 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1016206081 6:141470500-141470522 GTTTCTAGGGCCTAATAAACAGG + Intergenic
1016296261 6:142576256-142576278 GTTTGTATAGCCTAATAAGCAGG - Intergenic
1021498782 7:21306471-21306493 GTTTCTCTAGCCTCACAAGCTGG + Intergenic
1021604372 7:22395346-22395368 GTTTCCAGCGCCTGAAAAGCAGG + Intergenic
1023782141 7:43666346-43666368 TTTTTTAGGGCCTAATAAGCAGG - Intronic
1024398062 7:48891411-48891433 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1024491238 7:49987564-49987586 GTTTCCAGGGCCTAATAAACAGG - Intronic
1028146523 7:87326201-87326223 GTTTCTAGGGTCTAATAAACAGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1031395037 7:121263369-121263391 ATTTTAAGTGCCTAACAAGGTGG + Intronic
1031745121 7:125486642-125486664 GTTTCCAGTAGCTAAAAAGCTGG + Intergenic
1033821468 7:145139469-145139491 TTTTCTAGTTTGTAACAAGCAGG + Intergenic
1034231485 7:149532093-149532115 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1035827535 8:2660591-2660613 GTGTCTAGTGTCTAATGAGCTGG + Intergenic
1036445390 8:8817647-8817669 GTTTCTAGTGCCAAACAGGTTGG - Intronic
1037471279 8:19213695-19213717 GTTTCTGTTTCCTCACAAGCAGG - Intergenic
1038400649 8:27281939-27281961 GTTTCTAGTGGTTAAGAGGCTGG - Intergenic
1039287346 8:36056447-36056469 TCTTCTTTTGCCTAACAAGCAGG - Intergenic
1040088865 8:43374574-43374596 GCTTCTAGGGCCTAACATGAAGG - Intergenic
1040089646 8:43384756-43384778 GTTTCTAGGACCTAATAAACAGG + Intergenic
1040404031 8:47082379-47082401 GTTTCTAGGGCCTAACATGCAGG + Intergenic
1041605058 8:59772306-59772328 GTTTCTAGGGCCTAATGAGCAGG + Intergenic
1042979232 8:74506932-74506954 GTTTCTAAGCCCAAACAAGCAGG - Intergenic
1043012985 8:74903278-74903300 GTTTCAAGAGCCTAATAAGCAGG - Intergenic
1043706319 8:83355798-83355820 GTTTCTGGGGCCTAATAAGGAGG + Intergenic
1044449811 8:92321686-92321708 ATTTCTAATGCCTATCAAGTAGG + Intergenic
1045846243 8:106639575-106639597 CTTTGTAGTGCCTAAAAAGAAGG + Intronic
1046202804 8:110949987-110950009 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
1046579049 8:116068741-116068763 GCTTCTAGGGCCTAAGAAGCAGG - Intergenic
1047581556 8:126222023-126222045 GTTTCTAGGGCCTAATAAACAGG + Intergenic
1050929371 9:11304243-11304265 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1053630555 9:39933847-39933869 GTTTCTAGGGCCTAATAAACAGG + Intergenic
1053775215 9:41529662-41529684 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1054213332 9:62316854-62316876 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1055861197 9:80751337-80751359 TTTTTTAGTGAATAACAAGCAGG + Intergenic
1056064400 9:82918370-82918392 GTTTCTAGTGGCTACCATACTGG - Intergenic
1056726997 9:89127907-89127929 GTTTCTACAGCCTAATAAGCAGG - Intronic
1057780783 9:98048306-98048328 GTTTCTAGGACCTAATAAGCAGG - Intergenic
1058015959 9:100032193-100032215 GTTTCTACAGCCTAATAAGCGGG - Intronic
1058355651 9:104081170-104081192 GTTTCCAGGGCCTAATAAGCAGG + Intergenic
1059796369 9:117701644-117701666 GTTTACAGTTCCTAAGAAGCGGG + Intergenic
1060306725 9:122420482-122420504 GTTTCTAGGGCCTAATAAGGAGG + Intergenic
1061830546 9:133290917-133290939 GTTTCTGGGGCCTAATAAGGAGG + Intergenic
1186397591 X:9225449-9225471 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
1186450224 X:9666208-9666230 GTTTCTAGGGCCTAATAAGCAGG - Intronic
1186554480 X:10543330-10543352 ATTTCTACTGCCAAACAAGGAGG - Intronic
1188159348 X:26781855-26781877 ATTTCTAGAGCCAAATAAGCAGG + Intergenic
1189086402 X:38029952-38029974 GTTTCTAGGGCTTAACTTGCAGG + Intronic
1189341807 X:40210226-40210248 GTTCCTTGTTCCAAACAAGCTGG + Intergenic
1190137629 X:47811767-47811789 GTTTCAAGGGCCTAGTAAGCAGG + Intergenic
1191070471 X:56395187-56395209 GTTTCCAGAGCCTAATAAGCAGG + Intergenic
1191946712 X:66541872-66541894 GCTTCCAGTGACTATCAAGCAGG + Intergenic
1192682307 X:73264330-73264352 CTTTCTAGAGCCTAATAAGCAGG + Intergenic
1192714340 X:73623987-73624009 GTTACTAGGGCCTAATAAGCAGG + Intronic
1192864769 X:75118931-75118953 GTTTCTAGGGCATAATAAGCAGG - Intronic
1192888661 X:75364271-75364293 GTTTCTACAGCCTAATAAGCAGG - Intergenic
1193546657 X:82838957-82838979 GCTTCTAGAGACTAATAAGCAGG - Intergenic
1193791153 X:85816322-85816344 ATTTTTAGGGCCTAATAAGCAGG - Intergenic
1194051732 X:89077878-89077900 GTTCTTAGGGCCTAATAAGCAGG + Intergenic
1194059532 X:89180394-89180416 GTTTCTAGGGCCCAATAAGCAGG + Intergenic
1194227444 X:91278946-91278968 GTTCCTAGGGCCTAATAAACAGG + Intergenic
1194379925 X:93179071-93179093 GTTTCTAAGGCCTAATAAGTAGG - Intergenic
1194850401 X:98861686-98861708 GGTTCTAGGGCCTAATAAGCAGG - Intergenic
1195558930 X:106261245-106261267 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
1195877099 X:109552830-109552852 GTTTTTAGGGCATAATAAGCAGG - Intergenic
1196563173 X:117174648-117174670 GTTTCTAGGGCCTAATAAACAGG - Intergenic
1197065510 X:122228763-122228785 GTTTCTAGGGACTAATAAACAGG - Intergenic
1197244591 X:124155051-124155073 GTTTCTAGGGCCTAATAGGCAGG + Intronic
1198181917 X:134218780-134218802 GTTTATAGGGCCTAATAAGCAGG + Intergenic
1198767812 X:140096099-140096121 GATTCCAGTGCATAAGAAGCAGG - Intergenic
1199994585 X:153013639-153013661 GTTTGTAGGGCCTATTAAGCAGG + Intergenic