ID: 1154365682

View in Genome Browser
Species Human (GRCh38)
Location 18:13706581-13706603
Sequence TTGCCCTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 14, 2: 53, 3: 53, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154365682_1154365687 18 Left 1154365682 18:13706581-13706603 CCTTCACTCTTCTAGAAGGGCAA 0: 1
1: 14
2: 53
3: 53
4: 165
Right 1154365687 18:13706622-13706644 TTCACGGTTTGGAATAAAAGAGG 0: 1
1: 2
2: 10
3: 40
4: 143
1154365682_1154365684 2 Left 1154365682 18:13706581-13706603 CCTTCACTCTTCTAGAAGGGCAA 0: 1
1: 14
2: 53
3: 53
4: 165
Right 1154365684 18:13706606-13706628 TTTGTTAGGTCCTTTTTTCACGG 0: 3
1: 43
2: 38
3: 58
4: 380
1154365682_1154365688 19 Left 1154365682 18:13706581-13706603 CCTTCACTCTTCTAGAAGGGCAA 0: 1
1: 14
2: 53
3: 53
4: 165
Right 1154365688 18:13706623-13706645 TCACGGTTTGGAATAAAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 139
1154365682_1154365685 7 Left 1154365682 18:13706581-13706603 CCTTCACTCTTCTAGAAGGGCAA 0: 1
1: 14
2: 53
3: 53
4: 165
Right 1154365685 18:13706611-13706633 TAGGTCCTTTTTTCACGGTTTGG 0: 1
1: 1
2: 17
3: 20
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154365682 Original CRISPR TTGCCCTTCTAGAAGAGTGA AGG (reversed) Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
905503615 1:38459027-38459049 TTGCCCCTCTAGGAAAGTAAAGG - Intergenic
906965031 1:50447986-50448008 TTGCATTTTTAGAAGTGTGAGGG + Intronic
907142882 1:52204792-52204814 TTTCCCTGCCAGAAGAATGAGGG + Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910049669 1:82959462-82959484 TAGCCCTTTTGCAAGAGTGAGGG - Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
913133053 1:115859989-115860011 GTGCCAGTCTAGAATAGTGAGGG - Intergenic
913235423 1:116776895-116776917 TTGCATTTTTAGAAGAGAGACGG - Intergenic
913398591 1:118402016-118402038 TTTCTCTTCTAGAAGTGTTATGG - Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923127589 1:231046074-231046096 TTGTCCTGCTACAAGAGTGGTGG - Intergenic
923579786 1:235198026-235198048 TTGCTCTATTAGAAGAGTTATGG + Intronic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1067570037 10:47365010-47365032 TTCCACATCTAGAAGAGGGAAGG - Intergenic
1072449307 10:95526743-95526765 TGGACCTTCCAGAACAGTGAAGG - Intronic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1074228436 10:111510576-111510598 TTGCCCTCCAACAAGAATGAGGG - Intergenic
1074336016 10:112576320-112576342 TGGCCCTTTTAGAAGAGGCAGGG - Intronic
1074708254 10:116155345-116155367 TTCCCCCTCTAGCAGAGGGAAGG + Intronic
1077938251 11:6813236-6813258 TGCCCCTCCCAGAAGAGTGATGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083132858 11:60642407-60642429 TGGACCTTCTAGAAAACTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092684647 12:11028333-11028355 TAGCCCTTCTGGAAAAGTGCTGG + Intronic
1092686966 12:11059210-11059232 TAGCCCTTCTGGAAAAGTGCTGG + Intronic
1092781837 12:11994800-11994822 TTGCCCTTGGAGAAAGGTGAAGG - Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093358773 12:18199450-18199472 TAGTCCTTTTACAAGAGTGAGGG - Intronic
1094262023 12:28511516-28511538 TTTCCCCTCAAGAAGAATGAGGG + Intronic
1094346758 12:29478586-29478608 TTTCCCTTCTAGAAGGGTTAAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102197651 12:111035923-111035945 TGGCCTTTCTGGAAGAGTGGGGG + Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106533941 13:30621799-30621821 TTGCCCTGCTTGTAGAGAGAAGG + Exonic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1107229295 13:38088316-38088338 TGACCCTTCTAAAAGAGTGGAGG + Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1109275807 13:60302873-60302895 TTTCCCTTCTAGAAGTTTCAAGG - Intergenic
1109641701 13:65200158-65200180 TAGCTCTTCTATAAAAGTGAAGG + Intergenic
1110232069 13:73177519-73177541 TTGTTTTTCTAGTAGAGTGATGG - Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116576586 14:46583054-46583076 GATCCCTTTTAGAAGAGTGAAGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1126723365 15:51605996-51606018 TTGCTAATCTAAAAGAGTGAGGG + Intronic
1126740890 15:51775069-51775091 GGGCCCTTCTGGAAGATTGAAGG + Intronic
1127278298 15:57467167-57467189 TTACCCTTCCAGGAGATTGAAGG + Intronic
1128017839 15:64363260-64363282 TTGCACTTTTAGTAGAGTCAGGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1129453132 15:75661833-75661855 TTTCCCCTCTAGATGAGTGAAGG + Exonic
1130513380 15:84607283-84607305 TTCCACTTCTACCAGAGTGATGG + Intronic
1130830217 15:87591656-87591678 TTGCCTTTCTAGGAGAGAGGAGG - Intergenic
1130893754 15:88154437-88154459 TTGGCCTTCAAGAAGAATGTTGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1133283630 16:4680661-4680683 TTTCCTTTCTAGAGGGGTGAGGG + Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1135949727 16:26902908-26902930 TTCACCGTCTGGAAGAGTGATGG + Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG + Intergenic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1143152723 17:4817222-4817244 CTGCCCTCCTGGAAGTGTGAAGG - Exonic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145231157 17:21174317-21174339 TTGTCCTTGTAGAATAGTGTGGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1153261193 18:3226005-3226027 TTGCACTTCGAGAAGAGAGATGG + Intergenic
1153881650 18:9426461-9426483 TTGTACTTTTAGAAGAGTCAGGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157109714 18:44809207-44809229 TTGCCTTTATAGGAGAGTGAAGG - Intronic
1158179580 18:54698741-54698763 TTTCCCTACTAGTAAAGTGAAGG - Intergenic
1159622716 18:70656894-70656916 TTTCTCTTCTGTAAGAGTGACGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1162126874 19:8504207-8504229 TTGCAGTTCTGGAGGAGTGAGGG + Intergenic
1162149951 19:8637980-8638002 TTGCTCTTGTAGAACAGAGAAGG + Intergenic
1163766634 19:19166764-19166786 CTGCCCTTCTGGAAGATTCAAGG - Intronic
1164424052 19:28124505-28124527 TTCCCCTTCTACATGAGTGTGGG + Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1165327821 19:35124562-35124584 GTGCCCTTCTAGATGGGCGACGG - Exonic
1168152379 19:54456027-54456049 CTGCCCCTCTAGGAGGGTGAAGG - Exonic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
932018954 2:68063086-68063108 TTGCCTTTGGAGAAGAGTTAAGG - Intronic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
935330571 2:101974598-101974620 TTGCCCTGATTGGAGAGTGATGG - Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
936554415 2:113481471-113481493 TTTGCCTTGAAGAAGAGTGAGGG - Intronic
940285359 2:152028053-152028075 TTGCCCTTGTAGAAGGGAGCAGG - Intronic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
941599374 2:167522139-167522161 TTTCCCTTCTAGAAGCCTTATGG - Intergenic
942694923 2:178630936-178630958 TTCCCGATCTAGAAAAGTGAAGG + Exonic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944606331 2:201354818-201354840 CTGGCCTTCAAGAAGAGAGAAGG - Intronic
944996519 2:205300968-205300990 TGGTCCTTGTAGAAAAGTGAAGG - Intronic
946097714 2:217290073-217290095 TTGCCTTTCAAGAAGATTAATGG - Intronic
947004971 2:225500754-225500776 TTGACCTTCTAGCAGAGAGATGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172780106 20:37431531-37431553 CTGCCCTTCAAGATGGGTGATGG + Intergenic
1173613850 20:44390161-44390183 TGGCTTTTCTAGAAGAGTGCAGG - Intronic
1174726192 20:52864661-52864683 TTGCAATTCTACAAGACTGATGG - Intergenic
1174961803 20:55166152-55166174 CTGCCCTTCAAGATGAGAGAAGG - Intergenic
1175657348 20:60782573-60782595 TTGAACTTCTAGAGAAGTGATGG + Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1179155860 21:38850650-38850672 TTGCCCTTCCAGAATTTTGAAGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1181847998 22:25728638-25728660 TTGCCTTTTTCAAAGAGTGAAGG - Exonic
1182256860 22:29045405-29045427 TAGCCCTTTTAGAACAGAGAAGG - Intronic
1182751030 22:32642330-32642352 TTGCCCTTCTAGAAAATGGTTGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951071413 3:18332973-18332995 TTGCCCTTCTAGGAATGGGAAGG - Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
952822265 3:37495609-37495631 TGGCCTTTCTAGAAGCATGATGG - Intronic
953131587 3:40144462-40144484 TGTCCCTTTTAGAAGAATGAGGG + Intronic
954775840 3:53017723-53017745 TTGCTTTTTTTGAAGAGTGAAGG - Intronic
957445562 3:80309985-80310007 TAGCCTTTCTAGAAAAGTGGAGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959560874 3:107779291-107779313 TTGCCCTTCAAGCACAGTGAAGG + Intronic
960966087 3:123105687-123105709 GTGCCCTTCTATAATAGTAAGGG - Intronic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
962864705 3:139438286-139438308 TGGCCTTTCTAGAATAGTTAGGG - Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964439981 3:156698214-156698236 TTGCACTTCTATAAGAGAGATGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965430338 3:168579102-168579124 TTGCCATTTTAAAGGAGTGATGG - Intergenic
966290455 3:178350418-178350440 TAGCCCTTGAAAAAGAGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
971141040 4:23924906-23924928 TTTCTTTTATAGAAGAGTGATGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973866593 4:55120264-55120286 TTACCCTCCTGGAAGAGTGCTGG - Intronic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974550296 4:63363394-63363416 CTGCTCTTCTAGATGAGTTATGG + Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975443103 4:74435285-74435307 TTACCCTACTAGAACAGAGAAGG - Intergenic
976622649 4:87144591-87144613 TTGCCCTTCCAACAGACTGAGGG + Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979780407 4:124644695-124644717 CAGCCCTTTTAGAAGATTGAGGG + Intergenic
980896012 4:138861054-138861076 TTGCCCATCTGTAAAAGTGAGGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
984553528 4:181187452-181187474 TTGTACTTCTAGAAAACTGAAGG + Intergenic
985863816 5:2495678-2495700 TTGCCCTTCTAGATGACCGCAGG - Intergenic
986131415 5:4935496-4935518 TTGAACTCCTAGTAGAGTGAAGG - Intergenic
986784305 5:11097858-11097880 TTGACCTATTAGAAGAATGAGGG - Intronic
987073593 5:14360081-14360103 TTCCCACTCTAGAAGAGAGAAGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993946807 5:94124767-94124789 CTGCCCTTGAAGAAGAGGGATGG + Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG + Intronic
1001514086 5:172342846-172342868 TGGCCCTTCTGGGAGAGGGATGG + Intronic
1003785893 6:9486677-9486699 TTGACCTTCCAGCAGAGTGAGGG + Intergenic
1004265707 6:14146679-14146701 CTGCACTTCTAGCAGAGTGTGGG - Intergenic
1004827525 6:19439263-19439285 TTTCTCTTCTAAAAGGGTGAAGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006562615 6:34926705-34926727 TTCTCCTCCTGGAAGAGTGAGGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011153247 6:84299077-84299099 GTGCCCATTCAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1017788559 6:157775740-157775762 TTGCCCTTTTATAATAGTGCTGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019837505 7:3403731-3403753 GTGCTCTTCTGAAAGAGTGAGGG + Intronic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1023824845 7:44002133-44002155 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1024439510 7:49399721-49399743 TTTACCTTCTAGAAGAGACAAGG - Intergenic
1026088394 7:67280907-67280929 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG + Intergenic
1027117996 7:75496212-75496234 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027441063 7:78219670-78219692 TTGCCCTTCTCCAACAGTCATGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028140771 7:87272807-87272829 CTGGCCTTGTAGAAGAGTAAAGG + Intergenic
1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1029753108 7:102555438-102555460 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029771059 7:102654521-102654543 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030144456 7:106339430-106339452 CTTCTCTTATAGAAGAGTGAAGG - Intergenic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034892866 7:154855913-154855935 TTCCCCTTCTTGAAAATTGATGG + Intronic
1036155751 8:6340427-6340449 TTGCACTTTTAGTAGAGTCAGGG + Intergenic
1038577705 8:28718969-28718991 TTGGCATTCTAGGAGAGAGATGG + Intronic
1038905157 8:31893372-31893394 TTCTCCTTATAGTAGAGTGAAGG + Intronic
1039259166 8:35751731-35751753 TTGGCATTCAAGAAGAGAGAAGG + Intronic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1045533099 8:103002750-103002772 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051310010 9:15759599-15759621 TTGGCCTTCTTGAAGATTGCAGG + Intronic
1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056921076 9:90789652-90789674 GTGCCCTGCTAGTAGAGTCAGGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186219531 X:7334620-7334642 GTGGCTTGCTAGAAGAGTGAGGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196809386 X:119616671-119616693 CTGCCATTATAGAAGAGTTAGGG - Intronic
1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG + Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197500029 X:127230922-127230944 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198961304 X:142186218-142186240 TGTCCCTTCCAGAAGAGAGAGGG + Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic