ID: 1154369231

View in Genome Browser
Species Human (GRCh38)
Location 18:13743530-13743552
Sequence CTGTAGACACAGGAAAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154369224_1154369231 10 Left 1154369224 18:13743497-13743519 CCATGTGCCTGAATTCCTAGGAG 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 268
1154369223_1154369231 11 Left 1154369223 18:13743496-13743518 CCCATGTGCCTGAATTCCTAGGA 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 268
1154369226_1154369231 3 Left 1154369226 18:13743504-13743526 CCTGAATTCCTAGGAGTCCTGGC 0: 1
1: 0
2: 0
3: 8
4: 190
Right 1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 268
1154369227_1154369231 -5 Left 1154369227 18:13743512-13743534 CCTAGGAGTCCTGGCAAACTGTA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154369231 Original CRISPR CTGTAGACACAGGAAAAGCT GGG Intronic
900432481 1:2609420-2609442 CTGTGGGCACAGGAAAAGGTTGG + Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901787815 1:11636268-11636290 CTGTGGACACAGGAAACACCCGG + Intergenic
904684855 1:32252502-32252524 CTGTAGACAGGAGAAAGGCTGGG - Intronic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905950404 1:41946084-41946106 CTCTGGAAACGGGAAAAGCTGGG + Intronic
906810704 1:48824378-48824400 CTGAAGGCACAGGAATAGATAGG + Intronic
907037397 1:51228701-51228723 CTCTGGAAACGGGAAAAGCTGGG + Intergenic
907590021 1:55657613-55657635 CTGTTGACACATGAACAACTTGG - Intergenic
907622636 1:55996963-55996985 CTCTAAGCACAGGAAAGGCTGGG - Intergenic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908388985 1:63668427-63668449 CTGTAAACACTGAAACAGCTGGG + Intergenic
909973120 1:82014640-82014662 CTCTAGACACAGGGAAAGAAAGG - Intergenic
910012370 1:82481212-82481234 CTGAAGTCACAGGTAAGGCTGGG + Intergenic
910131592 1:83914221-83914243 TTGTAGAAACATGAAAAGTTTGG - Intronic
910540653 1:88352470-88352492 ATTTAGACACAGGGAGAGCTTGG - Intergenic
910689974 1:89955651-89955673 CCAAAGACCCAGGAAAAGCTGGG - Intergenic
910927277 1:92410168-92410190 TGGTAGAGACAGGAAAGGCTGGG - Intergenic
913075264 1:115336677-115336699 CTGTAAACACAGGATAAGAAGGG + Intronic
913317646 1:117566121-117566143 TCATGGACACAGGAAAAGCTTGG + Intergenic
914857716 1:151364657-151364679 ATGTAGACACAGTAAAAGGAGGG - Exonic
915191451 1:154154413-154154435 CTGTAGGAACAGGAAAACTTGGG - Intronic
916318208 1:163473809-163473831 CTTTAGAAACAAGCAAAGCTGGG + Intergenic
920512594 1:206562024-206562046 CTGTAGACCCAAGAAAGCCTAGG - Intronic
924299354 1:242621627-242621649 CTATACACAAAGTAAAAGCTTGG + Intergenic
1063123471 10:3121174-3121196 CAGTGAACACAGGAAAACCTGGG - Intronic
1064240572 10:13624394-13624416 CTGTAGAAACTAGAAAACCTGGG + Intronic
1064676193 10:17762834-17762856 CTGTAGAGACAGGATTTGCTAGG + Intronic
1066055118 10:31673709-31673731 CTGTAGACCAAGGAAATGTTGGG + Intergenic
1066162552 10:32749118-32749140 CTGGAGAAACAGGTAAAGATAGG - Intronic
1067300467 10:45003497-45003519 CAGTAGACTCAGAAGAAGCTTGG + Exonic
1067654628 10:48181705-48181727 CTTTAGATACAGGAAAATTTAGG - Intronic
1068658390 10:59597336-59597358 CAGTAGAGACAGAAAGAGCTAGG + Intergenic
1068828122 10:61462564-61462586 CTTTAGCCACAGTGAAAGCTGGG - Intergenic
1068981744 10:63070012-63070034 CTGTAGACTCAGAAAATGGTTGG + Intergenic
1073556164 10:104453883-104453905 TTGAAGATACAAGAAAAGCTGGG - Intronic
1075622776 10:123939929-123939951 CTGTCCACACAGGCAGAGCTGGG + Intronic
1077617214 11:3685381-3685403 CAGTGGACACAGAAAAAGCAGGG + Intronic
1077978806 11:7277863-7277885 CTGTAGACATCTTAAAAGCTAGG + Intronic
1078772335 11:14362500-14362522 CTGAAGACACAGGAGAATATGGG + Intronic
1079322785 11:19465336-19465358 CTGTAGATATGGGAAAATCTTGG - Intronic
1081026129 11:38017428-38017450 CTGTAGACTCAGGAGTAGGTGGG - Intergenic
1082691352 11:56308360-56308382 CTGGAGCCACAGGAAAAGCTGGG + Intergenic
1083399086 11:62411553-62411575 CTGCAGAAACAGGGAAAGCCAGG + Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1086454783 11:86950676-86950698 CTATAAACACTGGAAACGCTGGG - Exonic
1086641637 11:89165517-89165539 CTCTTGACAGAGGAAAAGATGGG + Intergenic
1087990508 11:104742214-104742236 GTGGAAACACAGGAAAAGGTTGG + Intergenic
1089330831 11:117687983-117688005 CTGCAGACCCAGGACAAGCATGG + Intronic
1090902439 11:131044753-131044775 TTGTAGATTCAGGACAAGCTGGG + Intergenic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1091903754 12:4165816-4165838 CTGGAGTCTCAGGAAAAGCAGGG - Intergenic
1094320632 12:29179010-29179032 CTGAAGACACAGGAAAAAGATGG - Intronic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1094591267 12:31823214-31823236 TTGGAGACTCAGGAAAAGGTGGG - Intergenic
1096228979 12:49887127-49887149 CTGTAGACAGAGGCAAAGCTGGG - Intronic
1097207248 12:57333242-57333264 CTGGAGATAGAGGAATAGCTGGG - Intronic
1097624574 12:61984135-61984157 GTGTAGACACACTAAAAGCAAGG + Intronic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1100270345 12:93018734-93018756 ATGAAGATACAGGAAAAGGTAGG - Intergenic
1100605381 12:96148111-96148133 CTGTACAAACAAGAAAAGTTAGG - Intergenic
1101474929 12:105036724-105036746 ATGTATGCACAGGAAAAGCATGG - Intronic
1101780876 12:107834197-107834219 CTGTAGACCCATGTAAACCTAGG + Intergenic
1102882271 12:116494687-116494709 CTGAAGACAAAGGAGAAGCCTGG + Intergenic
1103987698 12:124778587-124778609 CTGTGGAGAAAGGCAAAGCTGGG + Intronic
1105827932 13:24139133-24139155 GTGTAGACCCAGGAACAGCAAGG - Intronic
1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG + Intronic
1107200288 13:37706974-37706996 CTGTTTACACAAGAAAAGCAAGG - Intronic
1107613472 13:42140228-42140250 CTGCTGTCACATGAAAAGCTTGG + Intronic
1109718826 13:66251476-66251498 CTCTAGACACTGGAAAAGCAAGG - Intergenic
1110623766 13:77628741-77628763 CTGCAGAGAATGGAAAAGCTAGG + Intronic
1111156036 13:84327794-84327816 CTGAAAACACACCAAAAGCTAGG - Intergenic
1111411258 13:87880187-87880209 CAGAAGACATAGGAAAAGCAAGG + Intergenic
1112728476 13:102332154-102332176 TTGTAGAGATAGGAAAAGATGGG + Intronic
1112740997 13:102472512-102472534 CTGCAGACCCAGGAAAAGGCAGG - Intergenic
1113449246 13:110394974-110394996 CTGGAGACACATGGAAAGATAGG + Intronic
1114668303 14:24394763-24394785 CAACAGACACATGAAAAGCTAGG - Intergenic
1116657654 14:47673174-47673196 CAGTGGACACAGTAAAGGCTGGG + Intronic
1117549036 14:56816229-56816251 CTGTAGATAAAAGAAAAGCATGG - Intergenic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1118787893 14:69061461-69061483 CTGTGGACACAGGCCAGGCTAGG + Intronic
1119372598 14:74160158-74160180 CTTTATACAAAGGAAAAGTTTGG + Intronic
1119961877 14:78867830-78867852 CCGAAGACACAGGGAAATCTGGG - Intronic
1122883008 14:104698494-104698516 TTATAGACACAGGGAAGGCTCGG + Intronic
1126195126 15:45922847-45922869 CTGCAGCCACAGAAAAAGATTGG - Intergenic
1126938024 15:53733436-53733458 ATGTAGCCACAGGAAGAGCTGGG - Intronic
1126957522 15:53950720-53950742 CTGAAGACACAGAAATAGCCAGG + Intergenic
1129343343 15:74900600-74900622 CTGCAGACACAAGAAAGGCCTGG + Exonic
1130399136 15:83532953-83532975 CTGTAGTCACAAGGAATGCTGGG + Intronic
1130983111 15:88826476-88826498 CTGGAGACACAGGGAAAGCCAGG + Intronic
1131432826 15:92400480-92400502 CTAGATACACAGGAAAAGCAGGG - Intronic
1132851190 16:2025744-2025766 TTGGAGACAGAGGAAGAGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1136475496 16:30510645-30510667 CTTTAGAATCAGGCAAAGCTGGG + Intronic
1136692758 16:32047557-32047579 ATATACACAGAGGAAAAGCTGGG - Intergenic
1136793252 16:32990782-32990804 ATATACACAGAGGAAAAGCTGGG - Intergenic
1136876600 16:33863275-33863297 ATATACACAGAGGAAAAGCTGGG + Intergenic
1138107263 16:54294806-54294828 CTGAAGACAGAGGCAAAGATTGG + Intergenic
1139290042 16:65849718-65849740 CTCTAGACACAAGAGAGGCTGGG - Intergenic
1139327494 16:66163773-66163795 CTGTAGCCACAGGACCAGCGTGG + Intergenic
1139642019 16:68298581-68298603 CTGCAGTCTCAGGAAGAGCTTGG + Exonic
1140329836 16:74044605-74044627 ATCTACACACAGGAAAAGCATGG + Intergenic
1141241666 16:82270752-82270774 CTGTTGACACAGGGAAGGATAGG - Intergenic
1203095511 16_KI270728v1_random:1252473-1252495 ATATACACAGAGGAAAAGCTGGG - Intergenic
1142806701 17:2375230-2375252 CAGTAGCCACAGGAAGACCTGGG + Intronic
1144441664 17:15288022-15288044 CTGTAAACACCAGAAAAGGTGGG - Intergenic
1144623760 17:16833979-16834001 CTGTAGAAACAGGACTGGCTGGG + Intergenic
1144782986 17:17817137-17817159 CTATGGACAGAGGGAAAGCTGGG + Intronic
1144882670 17:18438737-18438759 CTGTAGAAACAGGACTGGCTGGG - Intergenic
1145149564 17:20505649-20505671 CTGTAGAAACAGGACTGGCTGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146757375 17:35445050-35445072 ATGGAGACTCAGGAAAAGATAGG + Exonic
1147578094 17:41613910-41613932 CTGTAGAAACAGGACTAGCCGGG + Intronic
1150345996 17:64405175-64405197 CTGAAGACAAAGGAAAAGGAAGG + Intronic
1150477400 17:65485574-65485596 ATGTAGACACAGGTAGATCTGGG - Intergenic
1150648210 17:66993001-66993023 CTGTAGACACAGCGCACGCTAGG - Intronic
1150659556 17:67063571-67063593 CTCCAGAAACAGGAAAAGCAAGG - Intergenic
1151386989 17:73761016-73761038 CTGTGCACACAGCAACAGCTCGG - Intergenic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1155487535 18:26362130-26362152 CTTTAGACTCAGAAAAATCTGGG + Intronic
1155612126 18:27677604-27677626 CTGTTCACACAGGTAGAGCTGGG + Intergenic
1156507603 18:37608256-37608278 CTGTAAACACAGGCAGAGCCAGG + Intergenic
1156543339 18:37938943-37938965 ATGTAGCCCCAGGAAGAGCTAGG + Intergenic
1157296253 18:46447408-46447430 CTGAAGAGAGAGGAAAGGCTGGG + Intronic
1158251443 18:55492383-55492405 CTGTACATCCAGGAAAATCTAGG - Intronic
1161579455 19:5072844-5072866 CTCTAGACACTGGAAAAGGCGGG - Intronic
1162085013 19:8243420-8243442 GAGTAGACACATGAACAGCTGGG - Intronic
1165461997 19:35949421-35949443 ATGTGGACACAGGAAATGCAGGG + Intergenic
926379986 2:12277365-12277387 CATTAGACACAGGAAAACGTCGG - Intergenic
926643420 2:15262693-15262715 ACATAGACACAGGAAAATCTGGG - Intronic
927316702 2:21691412-21691434 CTTCAGACACAGGAGAAGCTAGG + Intergenic
927638684 2:24833526-24833548 CTGCAGACACAGGGAAGGCAAGG - Intronic
927954547 2:27199438-27199460 CTGCAGACACAGGGACAGCAGGG + Intergenic
932672732 2:73752408-73752430 ATGTAGTCACAGAAAAGGCTAGG + Intergenic
933660359 2:84922709-84922731 CTGGAGACCCAGGAAAGCCTGGG - Intergenic
933717690 2:85373538-85373560 CTGGAGAAAAAGGAAAATCTGGG + Intronic
935104019 2:100022908-100022930 TTGTATACACAGGAAGAGATAGG + Intronic
936850870 2:116896105-116896127 CTGTACTTTCAGGAAAAGCTGGG + Intergenic
938310403 2:130285445-130285467 CTGGAGCCACAGGCCAAGCTGGG + Intergenic
942383667 2:175419623-175419645 ATCTAGACATAGGTAAAGCTGGG - Intergenic
942557588 2:177187737-177187759 CTGTAGAAATAGGAGATGCTGGG - Intergenic
942704643 2:178756475-178756497 CTGAAGATGCAGGAAAATCTTGG + Exonic
942894221 2:181032147-181032169 CTCTAAACCCAAGAAAAGCTAGG - Intronic
1169025885 20:2370930-2370952 CTTTAAACACAGGAAAGACTGGG + Intergenic
1172815395 20:37682201-37682223 CTGTCGAGGCAGGAAATGCTTGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174979422 20:55376337-55376359 ATGTAGAATCAGGAAAAGCAGGG - Intergenic
1176079407 20:63264506-63264528 CTGGAGACACAGGGACAGCTAGG - Intronic
1179050109 21:37881853-37881875 CTGTAGACAAAAGGACAGCTGGG + Intronic
1179367760 21:40773932-40773954 TTGAAGACACAGTAGAAGCTGGG + Intronic
1180651032 22:17377058-17377080 CTTTAGACATAGGAACACCTAGG - Intronic
1181495251 22:23283954-23283976 CTGCAGGCACAGGGAAGGCTGGG - Intronic
1183097719 22:35563354-35563376 CTGGAGACAGAGGAAGTGCTGGG + Intergenic
1184010772 22:41746437-41746459 TTAAAGACACAAGAAAAGCTAGG - Intronic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
1184259551 22:43306812-43306834 CTCTAGACACAGGGAGAGCATGG - Intronic
1184276109 22:43410737-43410759 CTAGAGACAAAGGAAAAGCAAGG - Intergenic
1184493729 22:44825460-44825482 CTGTAGACACAACAGAGGCTGGG - Intronic
950395017 3:12727667-12727689 CGGTGGCCACAGGAAAAGATAGG - Intergenic
951221122 3:20069827-20069849 ATGCAGATACAAGAAAAGCTTGG - Intronic
951379839 3:21969440-21969462 CTGAAGACAAAGAGAAAGCTAGG - Intronic
951473008 3:23076607-23076629 CTGTAGCCACATGGACAGCTTGG + Intergenic
952413742 3:33072070-33072092 CTGTAGTCATACAAAAAGCTAGG - Intronic
954107363 3:48416452-48416474 CTGTAGGCACAGGGCAGGCTAGG + Intronic
955516888 3:59734848-59734870 CTGGAGTCTCAGGAAAAGCAAGG - Intergenic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG + Intergenic
958121377 3:89293714-89293736 CAGTAGACGAAGGAAAAGCAAGG - Intronic
958851139 3:99326980-99327002 CTCTAGACCCAAGAAGAGCTGGG - Intergenic
959979588 3:112500824-112500846 CTGTGAACACAGGAAAAGGAAGG - Intergenic
961850970 3:129817926-129817948 CTGTAGCCACTGGACTAGCTGGG + Intronic
962221629 3:133569227-133569249 CTGTAAATAAATGAAAAGCTTGG - Intergenic
963093326 3:141507860-141507882 CTGTAGCCACAAGAGAGGCTGGG + Intronic
964372952 3:156020051-156020073 ATTTAGAAACTGGAAAAGCTTGG + Intergenic
964769928 3:160213447-160213469 TTGCAGAAACAGGAAGAGCTAGG - Intergenic
965013516 3:163126833-163126855 CTGAAGAGACAGGAAAATATGGG - Intergenic
968055092 3:195685206-195685228 ATGCACACACAGGAAAAGGTAGG - Intergenic
968100808 3:195964011-195964033 ATGCACACACAGGAAAAGGTAGG + Intergenic
969488182 4:7484000-7484022 CTGTAGATACAGGAGAGCCTGGG - Intronic
969595968 4:8149474-8149496 CTGTGGACACAGACCAAGCTGGG - Intronic
970250985 4:14115856-14115878 GTGTATTCACATGAAAAGCTGGG + Intergenic
970389771 4:15596233-15596255 ATGTAGACAAAGTAAAAGATAGG + Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
974477489 4:62402569-62402591 CTGTGCACACAGGCAAAGGTGGG - Intergenic
976321970 4:83726523-83726545 TTTTAGAACCAGGAAAAGCTGGG + Intergenic
977387044 4:96354510-96354532 CTGTAGACAAGGGCAAAGCAGGG + Intergenic
978617720 4:110612834-110612856 CTGTTGACACAGGCAGAGCGGGG + Intergenic
979471959 4:121109592-121109614 CTGTAGACTAATGAAAAGCATGG - Intergenic
981594128 4:146399991-146400013 CTGTAGACAGAGTAAAGGCCAGG + Intronic
983197590 4:164824506-164824528 CTGAAGACACAGGAACACCAAGG - Intergenic
984245813 4:177274490-177274512 CTGTGGAGAAAGGAAGAGCTGGG + Intergenic
985222987 4:187727797-187727819 CTGAAGAAACAGGACAAGCTTGG + Intergenic
985502267 5:255845-255867 ATGCACACACAGGAAAAGGTAGG - Intronic
985699164 5:1360299-1360321 CTGTGGAAAAAGAAAAAGCTAGG + Intergenic
986929669 5:12802424-12802446 CTTTAGAGACTGGAAAAGATAGG + Intergenic
987060638 5:14240012-14240034 CTGAAGAGACAGGGAAACCTGGG - Intronic
987458915 5:18182794-18182816 CTGAAGACAGAGACAAAGCTTGG - Intergenic
988569261 5:32348021-32348043 TTGTAGTCACAGGAAGAGATAGG + Intergenic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
990825164 5:59891893-59891915 GTGTGGAAACAGGAAAATCTAGG - Intronic
990895763 5:60699208-60699230 ATGAATACACAGGAAAAGATGGG - Intronic
991119958 5:63001175-63001197 GTGAAGACAAAGGAAAAGATTGG - Intergenic
991618663 5:68522506-68522528 CTGCTGACACTGGAAAAGCCAGG - Intergenic
992208327 5:74452600-74452622 CTGAAGCCTCAGTAAAAGCTGGG + Intergenic
995164930 5:109028725-109028747 ATGTAGGAACAGCAAAAGCTAGG + Intronic
996293008 5:121876393-121876415 CTGAAGCCAAAGGAAAAGCCTGG + Intergenic
1000606474 5:163333032-163333054 CTGTAGCTACAAGAAAAGGTGGG + Intergenic
1002064678 5:176646178-176646200 CTGTGGCCCCAGGACAAGCTAGG - Exonic
1003846818 6:10182390-10182412 CTGCAGAAACAGGAAAGGTTTGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006080782 6:31565022-31565044 CTGTGAAGACAGGAAAAGCATGG + Intergenic
1007078995 6:39085465-39085487 CTGTAGACACCAGGAAGGCTGGG + Intronic
1007764585 6:44153065-44153087 CTGTAAACTCAGGAAAGACTTGG + Intronic
1007994971 6:46297400-46297422 CTGGAGGTTCAGGAAAAGCTTGG - Intronic
1010898600 6:81398087-81398109 CTGTAAATACAGGCAAATCTTGG - Intergenic
1011057915 6:83226048-83226070 CTGTAGGCACAGGTGAAGATAGG - Intronic
1012289102 6:97429156-97429178 CTTTAGTAACAGGAAAATCTGGG - Intergenic
1012903535 6:105037100-105037122 CTGTTCACACAGGAACAGATTGG - Intronic
1013006739 6:106081031-106081053 ATGTTGACTAAGGAAAAGCTGGG - Intergenic
1014039484 6:116808982-116809004 TTGTAGAGACAGGCAAAGCCTGG - Intronic
1014420064 6:121232878-121232900 CTCTAGATACAGCAAAAGCGGGG - Intronic
1014502890 6:122214549-122214571 CTGTAGAAAGAGAAAAAACTGGG + Intergenic
1015402167 6:132798878-132798900 ATGTAGACACAGAAAAGGCAGGG + Intergenic
1016444697 6:144119769-144119791 CTCTAGAAAAGGGAAAAGCTGGG - Intergenic
1017971294 6:159314795-159314817 CTCTGAACACAGGATAAGCTGGG + Intergenic
1018190384 6:161305016-161305038 CAGGAGGCACGGGAAAAGCTGGG + Intergenic
1018347269 6:162913239-162913261 CTGGGGACAGAGGAAAGGCTTGG - Intronic
1019056489 6:169227264-169227286 CTGTAGAACCAGCAAGAGCTGGG - Intronic
1019118938 6:169787930-169787952 CTGTTCACTCAGGAAAAGGTCGG - Intergenic
1019274022 7:166525-166547 CTGGAGGAACAGGAACAGCTGGG + Intergenic
1019536628 7:1532794-1532816 CTTTAGACTCAGAAACAGCTGGG - Intronic
1020259987 7:6525907-6525929 CTGTGGACACAGGAAAGGTCTGG + Intronic
1020842120 7:13231533-13231555 GTGTAGACACTGGAAAATCAGGG - Intergenic
1021281763 7:18728300-18728322 CTGTAGACAAAGGAAGAGGTTGG - Intronic
1023067710 7:36395299-36395321 CTTTAGAAACAAGAAAAGTTAGG - Intronic
1023471005 7:40519552-40519574 CAGTAGACACAGAAAATTCTTGG + Intronic
1024019498 7:45352992-45353014 CTGGAGAGACAGGTAAATCTTGG + Intergenic
1024229420 7:47352914-47352936 CTGTAGCCACATGAAAAGAGTGG - Intronic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024775828 7:52784312-52784334 CTGGAGAATCAGGAAAAGATTGG + Intergenic
1024809873 7:53196478-53196500 CTACAAACACAAGAAAAGCTTGG + Intergenic
1026144755 7:67737027-67737049 CGACAGACACAGGAAACGCTTGG - Intergenic
1026244782 7:68610164-68610186 CTCTGGACACAGGAAACGCAGGG - Intergenic
1028092167 7:86716488-86716510 CTCTAGAGTCAGGAAAACCTGGG - Intronic
1028155455 7:87424107-87424129 CTGTAGACATAGAAAAGGCATGG + Intronic
1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG + Intergenic
1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG + Intergenic
1032794520 7:135267108-135267130 CTCTAGACACTGGAAAAGTCTGG + Intergenic
1036208345 8:6821825-6821847 CTGTATACACTGTAAAAGTTAGG + Intronic
1040894029 8:52347261-52347283 CTGTAAAAGCAGGAAAAGCTTGG + Intronic
1041103253 8:54417677-54417699 CTGAAGATTCAGGAAAAGATGGG - Intergenic
1041108215 8:54461428-54461450 CTATAGAAAAAGGAAAGGCTTGG + Intergenic
1041273661 8:56134933-56134955 CTGTAGACAAAGACAAAGCAAGG - Intergenic
1042437490 8:68784185-68784207 CTTTAAACACAGGGAAAGCTTGG - Intronic
1042515194 8:69651993-69652015 CTCTAGAAACTGGAAAAGCAAGG - Intronic
1043001160 8:74761449-74761471 CTGCTGACATAGGAAAAGCAGGG - Intronic
1043803795 8:84645048-84645070 CTATACACAAAGGAAAAACTTGG - Intronic
1045366507 8:101481309-101481331 CTGTAGTCCCAGGCAAAGGTGGG - Intergenic
1046742271 8:117842166-117842188 CTTCAGACACAGCAAAACCTGGG + Intronic
1047189504 8:122665256-122665278 ATGAAGACACAAGAAAAGGTTGG - Intergenic
1048104180 8:131389283-131389305 CTGTGGCCCCAGGAAAAGCCTGG - Intergenic
1048956591 8:139542683-139542705 TTGTAGTGACAGGAAAACCTTGG + Intergenic
1051149622 9:14066333-14066355 ATGTTCACACAGGAAAAACTGGG - Intergenic
1051581880 9:18685355-18685377 CTGAAGACACTGGCAAATCTGGG - Intronic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053415111 9:37942548-37942570 CTGAAGGCTCTGGAAAAGCTGGG + Intronic
1057123767 9:92600431-92600453 CTGTACAAACAAGAAAAGTTGGG + Intronic
1058896482 9:109405033-109405055 ATGGTGTCACAGGAAAAGCTTGG - Intronic
1186507308 X:10103375-10103397 CTGTAGACAGATGGAAGGCTAGG + Intronic
1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG + Intergenic
1187209070 X:17211002-17211024 CTGTAGTCAGGGAAAAAGCTGGG - Intergenic
1188976614 X:36683267-36683289 CTGCATACACAGGGAAAGGTGGG + Intergenic
1191891434 X:65946774-65946796 CTCTAGAAACTGGAAAAGATTGG - Intergenic
1192607236 X:72531023-72531045 TTCTAGACAGAGGAAAAGCATGG + Intronic
1195174793 X:102305190-102305212 CTGTAGTGACTGGAAGAGCTGGG - Intergenic
1195184072 X:102381903-102381925 CTGTAGTGACTGGAAGAGCTGGG + Intronic
1195894477 X:109732394-109732416 CTATAGACATAGAAAAATCTAGG - Intronic
1197362469 X:125522717-125522739 CTGTAGAACCAGGAAGAGCTGGG + Intergenic
1198920484 X:141720386-141720408 TTGTAGACATAGGAAAACCTAGG + Intergenic
1199818503 X:151421683-151421705 CTGTGGACACAGAAAATGTTGGG - Intergenic
1199838624 X:151620384-151620406 CTCTAGGCACAGGAACAGATAGG + Intronic
1200036005 X:153330899-153330921 CTGTAGCTACAAGAGAAGCTGGG + Intergenic
1201724399 Y:17137171-17137193 CTGTGAAGACAGGAATAGCTGGG - Intergenic
1202339598 Y:23848492-23848514 CTGTAAACACGGGAAAATGTTGG - Intergenic
1202531168 Y:25821576-25821598 CTGTAAACACGGGAAAATGTTGG + Intergenic