ID: 1154370065

View in Genome Browser
Species Human (GRCh38)
Location 18:13752322-13752344
Sequence TCTCATTTGCAGGATATGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154370065_1154370068 1 Left 1154370065 18:13752322-13752344 CCAGCCATATCCTGCAAATGAGA 0: 1
1: 1
2: 1
3: 8
4: 143
Right 1154370068 18:13752346-13752368 TTCTAAACTTGTCTCTGAGAAGG 0: 1
1: 0
2: 1
3: 18
4: 587
1154370065_1154370069 4 Left 1154370065 18:13752322-13752344 CCAGCCATATCCTGCAAATGAGA 0: 1
1: 1
2: 1
3: 8
4: 143
Right 1154370069 18:13752349-13752371 TAAACTTGTCTCTGAGAAGGTGG 0: 1
1: 0
2: 0
3: 26
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154370065 Original CRISPR TCTCATTTGCAGGATATGGC TGG (reversed) Exonic
900872976 1:5318062-5318084 TCTCCTTTTCAGGATGTTGCAGG - Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904581139 1:31545110-31545132 TCTAATTTGCAGGCTTTGGGAGG - Intergenic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
908873072 1:68636931-68636953 TCTCATTTGGAGGTTTTGGATGG + Intergenic
910612599 1:89161086-89161108 GATCATTTGCAGGGTATGGATGG - Intronic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
911864682 1:103002781-103002803 TCTTCATTGCAGGGTATGGCAGG - Exonic
913327378 1:117638680-117638702 TCTCATTGGCAGGGGATGACTGG + Intergenic
916002826 1:160633272-160633294 TCTCACTTACTGGATATGTCTGG - Intronic
916635044 1:166659219-166659241 TCTCATTTGCAGGCTGTTGTGGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
919876799 1:201875239-201875261 TGTCATTTGCAAGATATCTCTGG - Intronic
920182687 1:204142285-204142307 TTGCACTTGCATGATATGGCAGG - Intronic
920978642 1:210810240-210810262 TCTCAATAGCAAGATAAGGCTGG - Intronic
1063843075 10:10093311-10093333 ACTCATTTGCAGGTTATTTCAGG - Intergenic
1064301333 10:14125629-14125651 ACACATTTGCAGGATTTAGCTGG - Intronic
1069361917 10:67652870-67652892 TCTCATTTGCTAGGTCTGGCAGG - Intronic
1070739857 10:78895667-78895689 TCTCATTTGCAGGACAAGAAGGG - Intergenic
1070949346 10:80418554-80418576 TCTCCCTTGCAGGACTTGGCCGG - Intronic
1072165830 10:92812266-92812288 TGCCATTTGCAGAAAATGGCAGG + Intergenic
1074761848 10:116672752-116672774 TCTTATTTGTAGAATATGGCTGG + Exonic
1075425574 10:122339379-122339401 TCTCATTGACTGGACATGGCCGG - Intergenic
1075581706 10:123623769-123623791 TCTCACTGGCAGGACATGGATGG - Intergenic
1075839104 10:125483106-125483128 TCTCATTTGCTGGAAATGTGGGG + Intergenic
1077755593 11:5024778-5024800 ACACACTTGCAGGATGTGGCCGG - Intergenic
1077910315 11:6567220-6567242 TCTCAATTGCAGTAGATGGCTGG - Exonic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079650764 11:22925986-22926008 TCACATTTGCAGAAAATGGTGGG - Intergenic
1079678851 11:23266708-23266730 TCTCTTTTGCAGGATGTTGTAGG + Intergenic
1082641186 11:55663551-55663573 TCTCATCTGCAGTATAAGGATGG - Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1087952294 11:104237707-104237729 TCTCATTTACATTATATGCCAGG + Intergenic
1088237989 11:107745517-107745539 TCTCAGTTGTTGGATATGACAGG - Intergenic
1088732267 11:112693931-112693953 TCCCATGGGCAGGATATAGCAGG + Intergenic
1089440479 11:118512014-118512036 TCTCATTTGCAGGTAATGGCTGG + Exonic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1093449517 12:19298944-19298966 TCTCCTCTACAGGCTATGGCTGG + Intronic
1094381322 12:29846508-29846530 TCTAATTTGGGGGATATTGCAGG + Intergenic
1095733836 12:45535335-45535357 TACTATGTGCAGGATATGGCTGG + Intergenic
1097065127 12:56315351-56315373 TCTACTTTCCAGGAAATGGCCGG + Intronic
1098548928 12:71741665-71741687 TCTCATTTGAAGTATATAGGAGG - Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104085370 12:125470048-125470070 TCCCATTTGCTGGTTATAGCTGG + Intronic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1106226681 13:27791722-27791744 TGTCATTTGAAGGAAAGGGCTGG + Intergenic
1107673377 13:42769807-42769829 TCTTATTTTCAGGAAAGGGCAGG + Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109600715 13:64624512-64624534 TATCATTTTCAGGAAATGGGAGG + Intergenic
1111722638 13:91965649-91965671 TTTCCTTTGTAGGATATGACAGG - Intronic
1112779566 13:102883908-102883930 TGTCATTTCCTGTATATGGCAGG + Intergenic
1112974617 13:105302122-105302144 TCTCATTTCTATTATATGGCAGG - Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115631611 14:35251418-35251440 TCTCATTTACAGGATAAAGAAGG - Intronic
1116242196 14:42359271-42359293 TCTCTTTTTCAGGATAAGGATGG - Intergenic
1119053929 14:71399283-71399305 TCTCATTTACAGGAAACGGATGG - Intronic
1120767197 14:88339314-88339336 TCTCATTTACAGGAAATGCAGGG - Intergenic
1124692813 15:31839519-31839541 TGTCTTTGGCAGGATATGCCTGG - Intronic
1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG + Exonic
1136061594 16:27730423-27730445 TCTCATTTGCAGTACTTGTCTGG + Intronic
1138614863 16:58157291-58157313 TCTCATTTGAAGGAGAGGCCAGG + Intergenic
1141207482 16:81944409-81944431 TCTAATTTAAAGGATATGGGAGG + Intronic
1153222230 18:2871692-2871714 TGTCATTTGGAGGTTATGGCAGG + Intronic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1156637645 18:39050436-39050458 TCTTCTTTTCAGGATTTGGCTGG - Intergenic
1156863403 18:41863889-41863911 ACTCATCTGCAGCATGTGGCAGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1166774384 19:45303395-45303417 ACTCATTTGCAGGTGAGGGCAGG - Exonic
1166991754 19:46697052-46697074 TGTGATTTGCAGGATCTGTCTGG + Intronic
925715267 2:6779249-6779271 TTTCATTTGCAAGAAATGCCAGG + Intergenic
931835833 2:66097627-66097649 TGTCATGTGCATGATATGGTGGG + Intergenic
932232533 2:70094595-70094617 TCTCACTGGCAGGAGGTGGCAGG - Intergenic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
935760721 2:106318143-106318165 TCTCATTTGTTAGATATAGCTGG + Intergenic
936153187 2:110032749-110032771 CCTCACCTGCAGGACATGGCGGG + Intergenic
936191494 2:110338666-110338688 CCTCACCTGCAGGACATGGCGGG - Intergenic
942609427 2:177727603-177727625 TCTCATTCGTAGGAACTGGCAGG - Intronic
943018097 2:182539001-182539023 TCTCATTTGCAAGATCTTGAAGG + Intergenic
943979913 2:194536123-194536145 TCTCATTGGGAGGAGATGGTTGG + Intergenic
944975197 2:205041959-205041981 TTTCATTTGGAGGATATGTTTGG - Intronic
947768423 2:232652113-232652135 ATTCATTTGAAGGGTATGGCTGG + Intronic
948913087 2:241015391-241015413 TCTCATTTTCTGGTTATTGCTGG + Intronic
1172900790 20:38333112-38333134 TCTCATTTGGTAGAAATGGCTGG - Intronic
1173213756 20:41059586-41059608 TCTCTTTTGCAGGGAAAGGCAGG - Intronic
1175446184 20:59021438-59021460 TGTCATTTAGAAGATATGGCTGG + Intronic
1178411504 21:32367304-32367326 TCTGATTTGTAGGATAGGGGAGG - Intronic
1180476481 22:15714182-15714204 TCACATGTGCAAGATATGACTGG - Intronic
949796413 3:7856017-7856039 TCTCTTTTGCAGAATCTGCCTGG - Intergenic
952625703 3:35400296-35400318 CCTGATTTGCAGCATATGGAAGG + Intergenic
952748922 3:36808343-36808365 TCTGTTTTGCAGGATTTGTCTGG - Intergenic
953297549 3:41735520-41735542 TCTCATGTGCAGTATATTACTGG + Intronic
953741718 3:45544403-45544425 TCTCAATAGCCGGATAAGGCAGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
970461116 4:16275874-16275896 TTTTAATTGCAGGATATGTCTGG + Intergenic
972981689 4:44712092-44712114 TCTTATTTGAAGGAAATGGAAGG + Intronic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
975224349 4:71853639-71853661 TCTTATAGGCAGCATATGGCTGG + Intergenic
975675010 4:76818663-76818685 TCTTATAGGCAGGAGATGGCTGG + Intergenic
977475735 4:97506995-97507017 TCTTATTAGCAGGATATAGTTGG - Intronic
980518625 4:133900756-133900778 TCTAATTTCCAGGATATTGCAGG + Intergenic
981343614 4:143650368-143650390 TGTCATTTATAAGATATGGCTGG - Intronic
982096510 4:151928234-151928256 TCTCACTAGCAAGATATGGCAGG + Intergenic
982146974 4:152405371-152405393 TTCGATTTGAAGGATATGGCTGG + Intronic
982238038 4:153270445-153270467 TCTGATTTGCAGTATATGCCTGG + Exonic
982675753 4:158373990-158374012 TCTAGTTTGCAAGATGTGGCAGG - Intronic
983516307 4:168660472-168660494 TCGCACTAGCAGGATGTGGCTGG - Intronic
991392903 5:66167672-66167694 TCTCAATTGCAGGGTAAGGTTGG + Intronic
991610486 5:68444893-68444915 TCACACTTACAGGATTTGGCAGG - Intergenic
991612018 5:68459262-68459284 TCCCACTTGAAGAATATGGCTGG - Intergenic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993873855 5:93283183-93283205 TCACATTTGCATGATAAGGAAGG + Intergenic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
1000028141 5:157377778-157377800 TCTCATTGGCATGATATGAGAGG - Intronic
1002832437 6:834894-834916 TTTCATTTGAAGGATTTTGCAGG + Intergenic
1005818346 6:29575857-29575879 GCACATTTTCAGGATTTGGCAGG - Intronic
1006611877 6:35298910-35298932 TCTCCTTTGGAGGATGGGGCAGG - Intronic
1007016868 6:38477404-38477426 TCTCATCTACAGGACATGCCAGG + Intronic
1012406420 6:98905425-98905447 TCTCTGTTGCAGGATTTAGCAGG - Exonic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1023622121 7:42084494-42084516 TCTGTTTGGAAGGATATGGCTGG - Intronic
1024285684 7:47755653-47755675 TCTGATTTCCAGGGTATGGTGGG + Intronic
1024842433 7:53602987-53603009 TCTCATTTACAGGCTTGGGCAGG - Intergenic
1031446456 7:121860793-121860815 TCTCATTGGCAGAATTTGGGAGG + Intergenic
1033137666 7:138798327-138798349 TCTCATCTGAAGGATTAGGCAGG + Intronic
1035171273 7:157018605-157018627 TCTCATTTACAGAATGTCGCAGG - Intergenic
1036102976 8:5807711-5807733 TCTCCTTTGCAGTTTACGGCTGG - Intergenic
1036987134 8:13546536-13546558 TCTTATTTACAGAATATGACTGG + Intergenic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1042805346 8:72764998-72765020 TCTCAATTGCAGAATATCCCAGG + Intronic
1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG + Intergenic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1047482544 8:125298529-125298551 CCTCATTAGCAGGATAATGCGGG + Intronic
1047794091 8:128236225-128236247 TGTGATTTGCAGAATCTGGCTGG - Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048463581 8:134643021-134643043 TGGCATTTCCACGATATGGCTGG - Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051714832 9:19971603-19971625 TGTCAATTGGATGATATGGCAGG + Intergenic
1056674091 9:88658592-88658614 TTCCATTTGGTGGATATGGCAGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1189216109 X:39325763-39325785 TCTCATTTGCAGAATATTTTAGG + Intergenic
1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1198511453 X:137355867-137355889 TCTCTTCTGCTGGATATGCCTGG + Intergenic
1199253457 X:145691535-145691557 TTTCAGTATCAGGATATGGCAGG + Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic