ID: 1154375807

View in Genome Browser
Species Human (GRCh38)
Location 18:13808739-13808761
Sequence CCCACAGTGAATTTCCTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154375807_1154375813 23 Left 1154375807 18:13808739-13808761 CCCACGAGGAAATTCACTGTGGG No data
Right 1154375813 18:13808785-13808807 AGTTCTATTGAATTTCACCCTGG 0: 3
1: 48
2: 92
3: 54
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154375807 Original CRISPR CCCACAGTGAATTTCCTCGT GGG (reversed) Intergenic
No off target data available for this crispr