ID: 1154378307

View in Genome Browser
Species Human (GRCh38)
Location 18:13827011-13827033
Sequence CCTGCTAGGTGGAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154378307_1154378315 -10 Left 1154378307 18:13827011-13827033 CCATCCACCCTCCACCTAGCAGG No data
Right 1154378315 18:13827024-13827046 ACCTAGCAGGCATGTGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154378307 Original CRISPR CCTGCTAGGTGGAGGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr