ID: 1154383903

View in Genome Browser
Species Human (GRCh38)
Location 18:13876246-13876268
Sequence GAGGGTTTGAGAGCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154383897_1154383903 9 Left 1154383897 18:13876214-13876236 CCATCTTTGTCAGGCCTGAGCTG No data
Right 1154383903 18:13876246-13876268 GAGGGTTTGAGAGCTGTTGCAGG No data
1154383895_1154383903 24 Left 1154383895 18:13876199-13876221 CCACGTGTGGGCAGACCATCTTT No data
Right 1154383903 18:13876246-13876268 GAGGGTTTGAGAGCTGTTGCAGG No data
1154383901_1154383903 -5 Left 1154383901 18:13876228-13876250 CCTGAGCTGTTGGGCAATGAGGG No data
Right 1154383903 18:13876246-13876268 GAGGGTTTGAGAGCTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154383903 Original CRISPR GAGGGTTTGAGAGCTGTTGC AGG Intergenic
No off target data available for this crispr