ID: 1154387047

View in Genome Browser
Species Human (GRCh38)
Location 18:13903339-13903361
Sequence TGGATATATACCCAAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2279
Summary {0: 1, 1: 6, 2: 93, 3: 586, 4: 1593}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154387040_1154387047 27 Left 1154387040 18:13903289-13903311 CCTTGAAAAATTAAAAATAGAGT 0: 1
1: 13
2: 99
3: 839
4: 3660
Right 1154387047 18:13903339-13903361 TGGATATATACCCAAAGGGAAGG 0: 1
1: 6
2: 93
3: 586
4: 1593
1154387043_1154387047 -7 Left 1154387043 18:13903323-13903345 CCAGAAATCCTACTGTTGGATAT 0: 1
1: 3
2: 40
3: 415
4: 2325
Right 1154387047 18:13903339-13903361 TGGATATATACCCAAAGGGAAGG 0: 1
1: 6
2: 93
3: 586
4: 1593
1154387041_1154387047 2 Left 1154387041 18:13903314-13903336 CCATATGATCCAGAAATCCTACT 0: 6
1: 218
2: 1902
3: 5627
4: 8930
Right 1154387047 18:13903339-13903361 TGGATATATACCCAAAGGGAAGG 0: 1
1: 6
2: 93
3: 586
4: 1593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154387047 Original CRISPR TGGATATATACCCAAAGGGA AGG Intronic
Too many off-targets to display for this crispr