ID: 1154387199

View in Genome Browser
Species Human (GRCh38)
Location 18:13904862-13904884
Sequence TAAGGTATAAGGAAGGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 10, 2: 73, 3: 166, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154387199 Original CRISPR TAAGGTATAAGGAAGGGGCC CGG (reversed) Intronic
900925897 1:5705834-5705856 GAGGGTATGAGGAAGGGGACAGG - Intergenic
901695053 1:11001324-11001346 TAAGGGATATGGAAGGGGCTGGG + Intergenic
902554721 1:17240170-17240192 CAAGGTGTCAGGAAGGGGCAGGG + Intronic
902855867 1:19204294-19204316 GAAAGTATAAGGGTGGGGCCAGG - Intronic
903235066 1:21944818-21944840 TAAGGGATAAAGGAGGGCCCAGG + Intergenic
903382622 1:22907577-22907599 GAAGGTGTATGGAAGGTGCCTGG - Intronic
904638358 1:31902367-31902389 GAAGGTGGAGGGAAGGGGCCAGG - Intergenic
904810032 1:33157480-33157502 CAAAGAATAAGGAAGGGGGCTGG - Intronic
905367271 1:37459659-37459681 TAAGGTAAAAGGTAGGAACCTGG - Intergenic
905749009 1:40445448-40445470 TATGGTAGAAGGAAGGGACAGGG + Intergenic
906090846 1:43178101-43178123 TAAGGTGTAAGGAAGGGATCCGG - Intronic
906485870 1:46234569-46234591 TAAAGTAGAAGGAAGGAGGCTGG - Intergenic
906904036 1:49868571-49868593 TAAGGTGTAAGGTAGGAGTCCGG - Intronic
907190090 1:52641090-52641112 CAAGGTATAAGGGAGGGGCGTGG - Intronic
907517689 1:55003195-55003217 AAAGAAATAAGGCAGGGGCCTGG - Intronic
907935249 1:59035977-59035999 TGTAATATAAGGAAGGGGCCAGG + Intergenic
908507676 1:64821731-64821753 TATGGTGTAAGGAAGAGGTCTGG - Intronic
908672872 1:66567681-66567703 TAAGGTGTAAGGAAGGGGTCTGG + Intronic
908878361 1:68703019-68703041 TAAGTTATAAGGAAGAGGGCAGG - Intergenic
908904336 1:68990752-68990774 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
909473057 1:76051099-76051121 TAAGGTATAAGGAAGGGGTCCGG + Intergenic
909996656 1:82288655-82288677 TAGGGTTTAAGGTAGGAGCCAGG + Intergenic
910331432 1:86076806-86076828 TAAGGTGTAAGGAAGGGGTCTGG - Intronic
910338893 1:86163528-86163550 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
910810401 1:91229934-91229956 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
912061681 1:105680390-105680412 TAAGGTGTAAGGAAGAGGTCCGG + Intergenic
912082083 1:105949273-105949295 TAAAGTGTAAGGAAGGGATCCGG - Intergenic
912709537 1:111940404-111940426 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
914345092 1:146792126-146792148 TAAAGTAGAAAGAAGGGGCCAGG - Intergenic
914964216 1:152238969-152238991 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
914966759 1:152266210-152266232 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
914967427 1:152272862-152272884 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
914968941 1:152289249-152289271 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
914969625 1:152295804-152295826 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
914969831 1:152297949-152297971 TAAGGTGTAAGGAAAGGATCCGG - Intergenic
916476792 1:165177244-165177266 TAATGTAAAAGGATGGGCCCTGG + Intergenic
916594349 1:166228832-166228854 TATGGTATAAGGAAGGGATCTGG + Intergenic
917212157 1:172642239-172642261 TAAGGTATGAGGAGGGGTCTGGG - Intergenic
917258670 1:173143345-173143367 TATGGGGTAAGGAAGGGGTCAGG + Intergenic
917597607 1:176544927-176544949 CAAGGTATGGGGAAGGGGCACGG + Intronic
918056256 1:181024041-181024063 CGAGGAATAAAGAAGGGGCCAGG + Intergenic
918156680 1:181854037-181854059 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
918249850 1:182692942-182692964 TATGGTGTAAGAAAGGGGTCTGG - Intergenic
918490634 1:185077948-185077970 TAAAGGACAAGTAAGGGGCCGGG + Intronic
918502256 1:185210399-185210421 TAAGGTGTAAGGAAGGGATCCGG + Intronic
918524399 1:185450113-185450135 GAAGGAAGAAGGAAGGGGACAGG - Intergenic
920320286 1:205116521-205116543 TAAGGTAAGAGCAAGGAGCCGGG + Intronic
920825963 1:209424531-209424553 CAAGGTGGGAGGAAGGGGCCTGG + Intergenic
920980814 1:210833497-210833519 TAAGGTGTAAGGAAGGAATCCGG - Intronic
921008870 1:211121493-211121515 TAAGGTGTAAGGAAGGGGTCTGG - Intronic
921590764 1:217000554-217000576 TAAGGTATAGGGAGGTGGTCAGG + Intronic
922446353 1:225701103-225701125 TAAGGTAGGAAGAAGGGGACAGG + Intergenic
922615924 1:226961225-226961247 TAAGAGATAAGAAAGGGCCCAGG - Intronic
924613705 1:245594346-245594368 TAAGGTATAAGGAAGGGGTCCGG + Intronic
924771476 1:247084210-247084232 TATGGTGTAAGGAAGGGGTCCGG - Intergenic
1063338442 10:5239728-5239750 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1063677498 10:8154557-8154579 AAACGTACAAAGAAGGGGCCAGG - Intergenic
1064563628 10:16617796-16617818 TAAGGTGTAAGGAAGGGGTCTGG - Intronic
1065737576 10:28768257-28768279 CAAGGCATGAGGAAGGAGCCTGG - Intergenic
1066523484 10:36249196-36249218 TAAGGGTTGAGCAAGGGGCCGGG + Intergenic
1067235916 10:44449414-44449436 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1067328640 10:45293682-45293704 CACGGCATAAGGAAGGGGACTGG - Intergenic
1067924390 10:50493280-50493302 TATGGCGTAAGGAAGGGGTCCGG - Intronic
1068562215 10:58527600-58527622 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1068891437 10:62152192-62152214 TATGGTGTAAGGAAGGAGTCCGG + Intergenic
1069234088 10:66048439-66048461 TGTGGTATAAGGAAGAGGTCCGG - Intronic
1069333677 10:67323394-67323416 TACGGTGTAAGGAAGGGGTCCGG + Intronic
1071765690 10:88662484-88662506 TAAGGTATAAGGAAGGGGTCTGG - Intergenic
1071927149 10:90423270-90423292 TAAGATGTAAGGAAGGGATCCGG + Intergenic
1072160285 10:92760001-92760023 TAAAATATAAGGATTGGGCCAGG + Intergenic
1072326601 10:94305070-94305092 AAAGGAATAAGGAAAGGCCCAGG - Intronic
1072583353 10:96759545-96759567 GAAGGGAAAAGGAAGGGGGCAGG + Intergenic
1074017728 10:109551254-109551276 TAAGGTGTAAGGAAGGGATCTGG - Intergenic
1074799230 10:116982325-116982347 TAAGGTATAAGGAAAGGAAAGGG + Intronic
1075213017 10:120507746-120507768 TAAGGGCTAAGAAAGGGGGCAGG + Intronic
1075557730 10:123445476-123445498 TCAGGTTACAGGAAGGGGCCAGG + Intergenic
1076329605 10:129654693-129654715 TGAGGTATGAGGAAGGTGGCCGG + Intronic
1077180001 11:1208008-1208030 TAAGTTCTGAGAAAGGGGCCTGG + Intergenic
1077667942 11:4131509-4131531 TAAGGTATACGGAAAGGTACAGG + Intronic
1078810599 11:14757981-14758003 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1078970935 11:16410459-16410481 AAAGATATGAGCAAGGGGCCAGG + Intronic
1079426518 11:20347598-20347620 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1079647946 11:22891038-22891060 CAAGGCATAAAGAAAGGGCCTGG - Intergenic
1079654315 11:22969406-22969428 TAAGGTGTAAGGATGGGGTCCGG + Intergenic
1079749849 11:24183833-24183855 TAAGGTATAAGGAAGGGATCCGG - Intergenic
1079965952 11:26980075-26980097 TAAGATGTAAGGAAGGGGTCTGG + Intergenic
1081079775 11:38727296-38727318 TAAGGTGTAAGGAAGGGGACAGG + Intergenic
1081081164 11:38740921-38740943 TAAGGTGTAAGGAAGGGGTCAGG + Intergenic
1081226141 11:40525144-40525166 TAAGGCTTAAGAAAGGGGCTGGG + Intronic
1081483473 11:43509364-43509386 TCAGGGAGAAGGAAGAGGCCAGG - Intergenic
1084311780 11:68321084-68321106 TATGGTATGAGGTAGGGGTCTGG + Intronic
1085003851 11:73066311-73066333 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1085145839 11:74196427-74196449 TATGGTGTGAGGAAGGGGTCTGG + Intronic
1086048524 11:82561472-82561494 TAGGGTTTAAGGATGGGGACAGG - Intergenic
1086333000 11:85772687-85772709 TGAGATATAAGTAAGGGGACTGG - Intronic
1086907145 11:92431689-92431711 TAAGGTATAAGGAAGGGATCCGG + Intronic
1086991513 11:93308801-93308823 TACAGTATAAGGAAGGGGTCCGG - Intergenic
1087442261 11:98201573-98201595 TAAGGTGTTAGGAAGGGGTCAGG + Intergenic
1087481001 11:98700187-98700209 TAAGTTTTAAGGAAGGGGTCCGG - Intergenic
1087502371 11:98973960-98973982 TAAGATGTAAAGAAGGGGTCCGG + Intergenic
1087794721 11:102443509-102443531 TAATGTATAAGGAAGGGATCCGG - Intronic
1087800915 11:102503146-102503168 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
1087959537 11:104331435-104331457 TAATGGATATGGAAGGGGCTGGG - Intergenic
1088134637 11:106539697-106539719 TAAGGTATAATGAAAGGACTTGG - Intergenic
1088270707 11:108031471-108031493 TATGGTATAAGAAAGGGGTCTGG + Intronic
1088306237 11:108411003-108411025 GAAAGTAAAAGGAAGGGGGCCGG - Intronic
1089162959 11:116453540-116453562 TAAGAAAGAAGGAAAGGGCCAGG + Intergenic
1089532722 11:119141638-119141660 TAAAGTATATGGGAAGGGCCGGG + Intergenic
1089951147 11:122527967-122527989 TATGGTGTAAGGAAAGGGTCTGG + Intergenic
1090495122 11:127204409-127204431 TATGGTGTAAGGAAGGGGTCCGG + Intergenic
1090570325 11:128038059-128038081 TAAAGTATAAGGAATTGGGCTGG - Intergenic
1091442067 12:518693-518715 TAAAGTATATGGGAGGGGCTGGG - Intronic
1091536001 12:1410002-1410024 TAAAGTATATGGGAGGGGCCAGG - Intronic
1091828137 12:3530661-3530683 CAATGTGTAAGGGAGGGGCCAGG + Intronic
1092215537 12:6679185-6679207 TAAGAGAAAAGGAAGGGGACGGG + Intronic
1093004889 12:14040739-14040761 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
1093154182 12:15660616-15660638 AAAGGTAAAAGGAAAGGACCAGG - Exonic
1093659143 12:21734378-21734400 TATGGTGTAAGAAAGGGGTCTGG - Intronic
1093895832 12:24573306-24573328 GAAGGAATAAGGAAGTGACCTGG + Intergenic
1095091023 12:38105353-38105375 TATGGTGTAAAGAAGGGGTCTGG + Intergenic
1095551643 12:43448454-43448476 TAAGATGTAAGGAAGGGTTCCGG - Intronic
1096952563 12:55488837-55488859 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1097011723 12:55957899-55957921 TAAGGGTTTAGGAAGGGGCAAGG - Intronic
1098184891 12:67885725-67885747 TTAGGTATAAGGAAGGGAAATGG + Intergenic
1098434650 12:70455645-70455667 TAAGGTGTAAGGAAGAGGTCCGG + Intergenic
1098695067 12:73542145-73542167 TAAGGTATAAAGAAGGGGTCAGG - Intergenic
1098717279 12:73846395-73846417 GAAGATGTAAGGAAGGGGTCCGG + Intergenic
1098858474 12:75681171-75681193 TAAGGTGTGAGGAAGGGGTTTGG - Intergenic
1099701483 12:86088186-86088208 TATGCTATAAGGAAGGGCTCCGG - Intronic
1100025846 12:90126950-90126972 TATGGTATAAGGAAGCAGTCAGG - Intergenic
1100284226 12:93149626-93149648 TTAGGATTATGGAAGGGGCCTGG - Intergenic
1101088688 12:101262278-101262300 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1101089043 12:101266152-101266174 TAAGTAATAAGCAAGAGGCCAGG + Intergenic
1101301228 12:103484835-103484857 TAAGGTGTAAGGAAGGGATCTGG + Intronic
1101549806 12:105751246-105751268 TAAGTAACAAGAAAGGGGCCAGG + Intergenic
1101784025 12:107865994-107866016 TGAGGTGTAAGGAAGGGGTCCGG - Intergenic
1102226429 12:111231810-111231832 TAAAGTATACAGGAGGGGCCAGG + Intronic
1102431865 12:112890158-112890180 GAATGGATGAGGAAGGGGCCAGG - Intronic
1102560729 12:113760452-113760474 TAAAGTATGAGGACGGGGCTCGG + Intergenic
1103018794 12:117517040-117517062 TGAGGAAAAAGGAAGGGGCATGG - Intronic
1103583864 12:121936722-121936744 TAGGGTTTCAGGGAGGGGCCTGG + Intronic
1103859166 12:123998157-123998179 TAAAGTATAAGAAAGGCTCCCGG - Intronic
1106372536 13:29149697-29149719 TATAGTGTAAAGAAGGGGCCTGG + Intronic
1106376928 13:29198247-29198269 TAAGGTGTAAGGAAGGGGTCTGG + Intronic
1107289366 13:38835125-38835147 TAAGCTGTAAGGAAGGAGTCCGG + Intronic
1107522490 13:41197231-41197253 TATGGTGTAAGGTAGGGGCAAGG - Intergenic
1107660270 13:42631965-42631987 TTAAGTATGAGGAAGGTGCCAGG + Intergenic
1108673576 13:52716525-52716547 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
1108887551 13:55206603-55206625 TAAGGTGTAAGGAAGGGATTCGG - Intergenic
1108998756 13:56768170-56768192 TAAGCTGTAAGAAAGGGGTCCGG - Intergenic
1109047240 13:57428641-57428663 TAAGGTGTAAGGAAGGGTCCAGG - Intergenic
1109966445 13:69704275-69704297 TAAGGTAAAAAGAAGGGTCAAGG - Intronic
1110631468 13:77713023-77713045 TAAGGTGTAAGGAAGGGGTCTGG - Intronic
1110737017 13:78948995-78949017 TAAGGTGTAAGGAAGGCGTCTGG + Intergenic
1111525274 13:89460251-89460273 TGTGGTGTAAGGAAGGGGTCCGG - Intergenic
1111989464 13:95102577-95102599 CAAAGTATAATGTAGGGGCCAGG - Intronic
1112027869 13:95428724-95428746 TAAGGTGTAAGGAAGGGTTCCGG + Intergenic
1112539232 13:100291115-100291137 TAAAGTATACGGAAAGGGCTGGG + Intronic
1113712055 13:112472319-112472341 TATGGTGAAAGGAAGGGGTCTGG - Intergenic
1114158004 14:20129061-20129083 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1114360973 14:21972257-21972279 TAAGGTATAAGGAAGGGATCCGG - Intergenic
1114425322 14:22616811-22616833 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1114943545 14:27648891-27648913 TAAGGTGTAAGGAAGGGTCCAGG + Intergenic
1115344257 14:32325556-32325578 TAAGGTATAAGAAAGGGGTCCGG - Intergenic
1116093078 14:40333589-40333611 CAAGGTATGATGAAGGGGCATGG - Intergenic
1116157096 14:41219256-41219278 TATGGTATAAGGAAGGGGTCTGG - Intergenic
1117004535 14:51406011-51406033 TATGGTGTAAGGAAGAGGGCTGG + Intergenic
1117551874 14:56844856-56844878 TAAAGTACAAGGGAGTGGCCGGG - Intergenic
1118218067 14:63828342-63828364 TAAAGTATATGGGATGGGCCTGG + Intergenic
1118558677 14:67054909-67054931 TAAGGTATAAGGAAAGGGTCCGG - Intronic
1119996440 14:79258498-79258520 AAATATATAAGGAATGGGCCAGG - Intronic
1120247559 14:82025035-82025057 TAAAGTGTAAGGAAAGGGTCCGG + Intergenic
1120357329 14:83451293-83451315 TAGGGTATAGTGAAAGGGCCAGG - Intergenic
1122367879 14:101206010-101206032 TAAGGTATAAGGAGGGGATCTGG + Intergenic
1123725575 15:23098060-23098082 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1124053043 15:26216681-26216703 TAAGGTGTAAGGCAGGGGTCTGG + Intergenic
1124425776 15:29561390-29561412 AAATGTAGAAGGAATGGGCCGGG + Intronic
1124715108 15:32052433-32052455 TAAGTTAGATGGAAGAGGCCAGG + Intronic
1125054149 15:35337994-35338016 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1125468995 15:39984029-39984051 TAAGGTGTAAGGAAGGGATTTGG + Intronic
1126201022 15:45986261-45986283 TAAGGTATAAGGAAGGGGTCTGG - Intergenic
1126567070 15:50112185-50112207 AAAGGGAAAAGGAAGGAGCCAGG + Intronic
1126954303 15:53914981-53915003 TAAAGTATAAGAAGGGTGCCGGG + Intergenic
1126967699 15:54074056-54074078 TAAGGTGTAAGGAAGGAGTCCGG + Intronic
1127413306 15:58731321-58731343 TAAAGTATATGGGAGGGGCCAGG + Intronic
1127631067 15:60828106-60828128 AAAGGTATAAGGCAGGAGGCGGG + Intronic
1127856849 15:62960444-62960466 GAAAGTGGAAGGAAGGGGCCAGG + Intergenic
1127879490 15:63143883-63143905 AAAGGTATGGGGAAGCGGCCAGG - Intronic
1128896198 15:71376320-71376342 TAGGGCATAAGGAAGGAGGCTGG - Intronic
1129042429 15:72701094-72701116 TAGGGAATAAGGAGGCGGCCTGG - Intronic
1129673644 15:77620836-77620858 TAGGGGAGATGGAAGGGGCCTGG + Intronic
1130000334 15:80041028-80041050 CAAACTATAAGGAAGAGGCCAGG + Intergenic
1130039102 15:80389665-80389687 TAAGGTGTAATGAAGGGGTCCGG - Intronic
1130386791 15:83419011-83419033 AAAGGTGTAAGGAAGGGGTCTGG + Intergenic
1130733410 15:86522968-86522990 GAAGGTAGAAGGAAGCAGCCAGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132912590 16:2322617-2322639 TAAGGTGTATGGAAGGGATCTGG - Intronic
1133472015 16:6084537-6084559 AAAAGAATGAGGAAGGGGCCAGG - Intronic
1134015047 16:10882431-10882453 TAAGAATTAAGAAAGGGGCCTGG + Intronic
1134344315 16:13375349-13375371 TAAGATGTAAGGAAGGGATCTGG + Intergenic
1135022754 16:18976663-18976685 CAAGGTATGGGGAAGGGGCTTGG - Intergenic
1137832202 16:51554636-51554658 TAAGGAATAAGGCAGGGGAAAGG + Intergenic
1137972399 16:52999120-52999142 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1138428655 16:56953250-56953272 CAAGGGCTGAGGAAGGGGCCGGG + Intergenic
1138568822 16:57854330-57854352 AAAAGTATAAAGATGGGGCCAGG + Intronic
1139988902 16:70923170-70923192 TAAAGTAGAAAGAAGGGGCCAGG + Intronic
1140030415 16:71333197-71333219 TAAGGCATAAGGAAGGGGTTCGG - Intergenic
1140538802 16:75736011-75736033 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1141016866 16:80458963-80458985 CAAGGAGAAAGGAAGGGGCCAGG + Intergenic
1142666170 17:1465126-1465148 TAAGGCAGAAAGAAGGGGGCAGG + Exonic
1143888507 17:10084761-10084783 TAAGATATAGGGAAAGGGGCCGG - Intronic
1144106905 17:11994544-11994566 AAAATTATAAGGAAGAGGCCAGG + Intronic
1147044781 17:37744372-37744394 TAAGGGATTGGGAAGGGTCCGGG + Intronic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1147747937 17:42707101-42707123 TCAGGTAGAAGACAGGGGCCTGG - Intronic
1148618870 17:49019727-49019749 TAAAGTATAAGTTAGGAGCCAGG - Intronic
1148657777 17:49301082-49301104 TTAGGTATAAGAAGGGGTCCTGG - Intronic
1149365908 17:55943911-55943933 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1150197030 17:63310150-63310172 TAAAATAGAAGGAAGAGGCCAGG + Intronic
1151096307 17:71503156-71503178 TAAGGAAAAATGAAGGGGGCAGG - Intergenic
1151568729 17:74915497-74915519 TCAGGTCTGAGGAAGGGCCCTGG - Intergenic
1154075176 18:11193213-11193235 CAAAGTAAAGGGAAGGGGCCAGG - Intergenic
1154212140 18:12389011-12389033 TTCAGTATAAGGATGGGGCCAGG + Intergenic
1154233214 18:12577108-12577130 TATGGTATGAGGCAGGGGTCTGG - Intronic
1154387199 18:13904862-13904884 TAAGGTATAAGGAAGGGGCCCGG - Intronic
1155129488 18:22917703-22917725 TAAGATATAATGTTGGGGCCGGG + Intronic
1155304797 18:24468335-24468357 TAAAGTATACGGGAGGGGCCGGG - Intronic
1156233960 18:35183261-35183283 GAAGGTACAAGGAAAGGGCCGGG - Intergenic
1156296392 18:35795552-35795574 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1157010719 18:43645174-43645196 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1157425505 18:47580957-47580979 AGAGTTATAAGGCAGGGGCCAGG + Intergenic
1158061953 18:53354952-53354974 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1158894892 18:61903529-61903551 TAAGGTGTAAGGAAGGGACATGG + Intergenic
1159427815 18:68311816-68311838 TAATGTGTAAGGAAGCAGCCAGG + Intergenic
1159452531 18:68620577-68620599 TAAGGTATAAGGAAGGTTTCCGG - Intergenic
1160483596 18:79265915-79265937 TATGGTGTAAAGAAGGGGTCCGG + Intronic
1161766405 19:6211279-6211301 TCAGGTATCAGGAAGAGGGCAGG - Intergenic
1161965810 19:7547956-7547978 TAAAGTATACTGAAGGGGCTGGG - Intronic
1162136380 19:8557880-8557902 GGAGGGAGAAGGAAGGGGCCTGG - Intronic
1162203730 19:9040169-9040191 TAAAGTCCTAGGAAGGGGCCAGG - Intergenic
1163924709 19:20329254-20329276 TAAAATATAAGAAAAGGGCCGGG - Intergenic
1164465622 19:28485180-28485202 AAAGTTTTAAGGCAGGGGCCAGG + Intergenic
1164807556 19:31128586-31128608 TAAGGACGAAGGAAAGGGCCAGG - Intergenic
1166542670 19:43615810-43615832 CAAGGTATAAGGGAAGGGGCAGG + Intronic
1166813622 19:45528502-45528524 TGAGGTAGATGGAAGGGGGCGGG + Exonic
1167661577 19:50798752-50798774 TGAGGCACAAGGCAGGGGCCCGG + Exonic
925749122 2:7071603-7071625 TAAAGTATAAGAAGGAGGCCTGG + Intergenic
926230234 2:10997284-10997306 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
926712210 2:15890725-15890747 TAAAGACCAAGGAAGGGGCCTGG + Intergenic
927581754 2:24257019-24257041 TATGGTACAAAGAAGTGGCCAGG + Intronic
927871311 2:26625912-26625934 TAAGGTATAAGGAAGGCATCTGG + Intronic
928883120 2:36119822-36119844 TAAGGTATAAGGAATATGCTGGG - Intergenic
929107672 2:38380003-38380025 TAAGATAGAAGGAATGGGCCAGG + Intergenic
930328148 2:49946560-49946582 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
930586397 2:53272247-53272269 TATGGTGTAAGGAAGGTGTCCGG - Intergenic
930598534 2:53416770-53416792 TAATGTATAAGGAAGCAACCTGG + Intergenic
931031189 2:58176593-58176615 TAAGGTGTAAGGAAGGGATCCGG - Intronic
932411405 2:71549988-71550010 CTAGGGATGAGGAAGGGGCCAGG - Intronic
932540114 2:72642577-72642599 TAAGGTGTAAGGAAGGGATCCGG - Intronic
932545369 2:72703100-72703122 TAAGGTGTAAGGAAGGGATCCGG + Intronic
932642861 2:73466974-73466996 TAAGGTATGATGTAGGGGACAGG - Intronic
932841087 2:75083103-75083125 TAAGGTGTAAGGAAGGGATCCGG + Intronic
932914339 2:75838933-75838955 TAATGTGTAAGGAAGGGGTCCGG - Intergenic
933059683 2:77722047-77722069 TATGGTGTAAGGAAGGAGTCCGG + Intergenic
934517327 2:94996904-94996926 CAAGGTATGGGGAAGGGGCATGG - Intergenic
935029755 2:99310724-99310746 GAAGATAGAGGGAAGGGGCCAGG + Intronic
935257098 2:101320307-101320329 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
935660031 2:105458693-105458715 TAAGGTGTGAGGGAAGGGCCGGG + Intergenic
935803062 2:106717800-106717822 GAAGGTGTAAGAAAGGGGGCTGG + Intergenic
935921045 2:108015443-108015465 TACAGTAGAAGGATGGGGCCAGG + Intergenic
936553544 2:113472663-113472685 TAAGGTGTAAGGAAGGGATCCGG + Intronic
936768689 2:115885431-115885453 TAAAATATAAGGTATGGGCCGGG - Intergenic
937188743 2:120071741-120071763 TAAGGTGTAAGGAAGGGTCCAGG - Intronic
937195693 2:120154458-120154480 TTAAATATAGGGAAGGGGCCGGG - Intronic
939022462 2:136975363-136975385 TAAGGTGTAAGGAAGGGGTCTGG + Intronic
939111142 2:138008739-138008761 TATAGTATAAGGAAGGAGACTGG - Intronic
939640442 2:144634407-144634429 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
940417646 2:153441125-153441147 TGAGGTGTAAGGAAGGGGTCCGG + Intergenic
940438601 2:153685829-153685851 TAAGGTATAAGGAAGGGGACCGG + Intergenic
940814493 2:158283092-158283114 TAAGGTGTGAGGAAGGGATCCGG - Intronic
941416808 2:165231256-165231278 AAAGCTATAATGTAGGGGCCGGG - Intergenic
941519091 2:166515843-166515865 TAAGGTATATACAAAGGGCCTGG + Intergenic
941559205 2:167023633-167023655 TAAGGTGTAAGGAAGGGATCTGG + Intronic
941608645 2:167632974-167632996 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
941973751 2:171381219-171381241 TAAGGTCTAAGGAAGGAGTCCGG - Intronic
942372266 2:175297812-175297834 TAAGGTGTAAGGAAAGGGTCCGG - Intergenic
944336320 2:198539566-198539588 GAAGGTGTAAGGAAGGGGTCCGG + Intronic
944371019 2:198984125-198984147 TATGGTGTAAGGAAGGGGTCCGG - Intergenic
944764770 2:202853015-202853037 TAAGGTGTAAGGAAGGGTTCTGG - Intronic
944802410 2:203249004-203249026 TAAGAAATAAGGCAGAGGCCAGG - Intronic
945623063 2:212166905-212166927 TAAGGTGTAAGGAAGAGGTCCGG - Intronic
945756200 2:213850021-213850043 TAAGGTAGCAGGAAGGTTCCAGG + Intronic
946134439 2:217634126-217634148 TAAGGCATAAGGCATGGTCCTGG - Intronic
947143130 2:227038244-227038266 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
947146376 2:227069682-227069704 TAAGGTGTAAGGAAGGGATCTGG - Intronic
947350325 2:229236719-229236741 CCAGGTAGAAGGAAGAGGCCAGG + Intronic
947978660 2:234389062-234389084 GAAGGTGTAAGGAAGGGGTCCGG - Intergenic
948699276 2:239750287-239750309 CAGGGTACAAGGAAGGGGTCTGG - Intergenic
948872184 2:240807436-240807458 TAAAATATATGGAAGGGGCTGGG - Intronic
949024670 2:241761241-241761263 TAAAGTATACAGGAGGGGCCGGG + Intronic
1168933059 20:1639798-1639820 TAAGGTGTAAGGAAGGGGTCTGG + Intronic
1169053988 20:2604834-2604856 TAAGGTATGGGCAAGGGGCTTGG - Intronic
1169959885 20:11147883-11147905 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1170100640 20:12695790-12695812 TAAGGATTAAGAAAGAGGCCAGG - Intergenic
1172112398 20:32554768-32554790 TAGGGGACAAGGAAGGGGCTAGG + Intronic
1172255170 20:33511313-33511335 TAAGGTGTAAGAAAGGGATCCGG + Intronic
1173002161 20:39112143-39112165 TGAGGTCTAAAGAAGGGTCCTGG + Intergenic
1177118346 21:17111739-17111761 TAAGGTATAAGGAAGGGGTTTGG - Intergenic
1177171707 21:17662496-17662518 CAAGATATCAGGAAAGGGCCGGG + Intergenic
1177758727 21:25378427-25378449 TATGGTATAAGGAAGGGGTCTGG - Intergenic
1177956140 21:27601599-27601621 TAAGGTTTAAGGAAGGGGTCCGG + Intergenic
1179588256 21:42387780-42387802 GAAGTCAGAAGGAAGGGGCCAGG + Intronic
1180763834 22:18230867-18230889 TAAGAAATAATAAAGGGGCCGGG - Intergenic
1180771812 22:18393675-18393697 TAAGAAATAATAAAGGGGCCGGG + Intergenic
1180803190 22:18643289-18643311 TAAGAAATAATAAAGGGGCCAGG + Intergenic
1181218526 22:21351971-21351993 TAAGAAATAATAAAGGGGCCGGG - Intergenic
1181809783 22:25396460-25396482 TATGGTATGAGGTAGGGGTCTGG - Intronic
1184110971 22:42394820-42394842 TAAGGTATAAGGATTGGGCCGGG + Intronic
1184142166 22:42584286-42584308 GAAAGTCCAAGGAAGGGGCCTGG - Exonic
1185034388 22:48464051-48464073 TAAGGTAAAAGGCAGGGGTCAGG + Intergenic
1185386981 22:50537922-50537944 TCAGGAGCAAGGAAGGGGCCGGG - Intergenic
1203233649 22_KI270731v1_random:134666-134688 TAAGAAATAATAAAGGGGCCGGG + Intergenic
949175623 3:1059003-1059025 TAAGGTGTAAGGAAGTGGTCCGG + Intergenic
949874393 3:8616334-8616356 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
951033160 3:17905138-17905160 TAAGGGCCAAGGAAGGGGCATGG + Intronic
952040459 3:29255580-29255602 TCAGGTAAAAACAAGGGGCCTGG + Intergenic
952159316 3:30677932-30677954 TAAGGTATAAGGAAGAGGGAAGG + Intronic
952900556 3:38109240-38109262 TAAGGCCTGAGGAAAGGGCCAGG + Intronic
953169700 3:40496024-40496046 TAAGATATAAAGAACAGGCCGGG - Intergenic
953622059 3:44541950-44541972 TAAGAAATAATGAATGGGCCGGG + Intergenic
954987621 3:54809611-54809633 AAAGAAAGAAGGAAGGGGCCGGG - Intronic
955172181 3:56577591-56577613 TAAGGTGTAAGGAAGGGAAGGGG + Intronic
955789451 3:62573175-62573197 TAATGTATATGGGAGGGGCCAGG - Intronic
956272286 3:67460919-67460941 TAAGATATAAAGAAGGGGAGGGG + Intronic
956470484 3:69561454-69561476 TAAGGCAGTAGGAAGGGGCAGGG - Intergenic
957092631 3:75747041-75747063 TAAGGTGTAAGGAAGGGATCTGG + Intronic
958157091 3:89769300-89769322 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
958413531 3:93847936-93847958 TAAGGTGTAAGGAAGGGATCTGG + Intergenic
958832829 3:99110338-99110360 TATGGAATAAGGAAGGGGCATGG - Intergenic
959930479 3:111977004-111977026 TAAGATATAAGGGATGGGCCAGG + Intergenic
960684106 3:120280025-120280047 GAAGACATATGGAAGGGGCCTGG + Intronic
962539991 3:136371533-136371555 TAAGGTGTGAGGAAGGGATCTGG + Intronic
962634388 3:137315411-137315433 TAAGGTGTAAGGAAGAGATCTGG + Intergenic
963760191 3:149280422-149280444 TCAGATGTAAGGAAGGGGCAGGG - Intergenic
963979695 3:151523630-151523652 TATGGTGTAAGGAAGGAGTCCGG - Intergenic
964639063 3:158888887-158888909 TAAGGTGTAAGGAAGTGGTCCGG + Intergenic
964715703 3:159719196-159719218 TGAGGTATAAGGAAGGGATCGGG - Intronic
965343387 3:167517484-167517506 TAAGATGTAAGGAAGGAGACCGG - Intronic
965618226 3:170616488-170616510 TAAGGTGTAAGAAAGGTGGCCGG + Intronic
966499769 3:180626332-180626354 AAAGGTATTACCAAGGGGCCTGG - Intronic
966817132 3:183898511-183898533 TAAGTTAAAAAGAGGGGGCCAGG - Intergenic
967478060 3:189943474-189943496 TAAAGCATAGGGCAGGGGCCAGG - Intergenic
967846443 3:194046874-194046896 TTAGAAGTAAGGAAGGGGCCGGG + Intergenic
968178961 3:196575970-196575992 TAAGATTCAATGAAGGGGCCGGG - Intronic
969940786 4:10728892-10728914 AAAAATATAAGAAAGGGGCCGGG - Intergenic
969976197 4:11104438-11104460 TAAGGTGTAAGGAAGAGATCAGG - Intergenic
970610634 4:17722008-17722030 GAAGAGTTAAGGAAGGGGCCAGG + Intronic
970695462 4:18671739-18671761 TATGGTATAAGGAAGAGGTGTGG + Intergenic
971690037 4:29821950-29821972 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
972233699 4:37104450-37104472 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
972282361 4:37614973-37614995 TAAGCTAAAAAGGAGGGGCCTGG + Intronic
972881411 4:43427751-43427773 TAAGATGTAAGGAAGGGGTCTGG + Intergenic
972919487 4:43920576-43920598 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
973678586 4:53291942-53291964 TAAGGCATAAGGAAGGGGTCTGG - Intronic
974050269 4:56935476-56935498 TAATGGATATGGAAGGGACCGGG - Exonic
974166929 4:58215476-58215498 TAAGGTAGAGGGAAGGAGCAAGG + Intergenic
974208143 4:58734351-58734373 TAAGATATAAGAAAGGGGGAAGG - Intergenic
974236805 4:59192227-59192249 TGAAATATCAGGAAGGGGCCGGG - Intergenic
974531694 4:63116322-63116344 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
975036878 4:69695278-69695300 TAAGGTGTAAGGAAGGGATCTGG + Intergenic
975058197 4:69962548-69962570 TAAGGTGTAAGGAAGGGACCCGG - Intergenic
975247207 4:72133178-72133200 CATGGTATAAGGAAGGGGTGTGG + Intronic
975296031 4:72735517-72735539 TAAGGTGTAAGGAAGGCATCTGG - Intergenic
975511657 4:75200160-75200182 TAAGGCGTAAGGAAGGGACCCGG + Intergenic
976522182 4:86041295-86041317 TAAGGTGTAAGGAACGAGTCTGG - Intronic
976993868 4:91405272-91405294 TAAGGTGTAAGGAAGGGATCTGG - Intronic
977184827 4:93923907-93923929 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
977968966 4:103190606-103190628 TAAGGTGTAAGGAAGGGATCTGG - Intronic
978277871 4:106973913-106973935 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
979097388 4:116568008-116568030 TAAGACATATGGAAGGGGTCTGG - Intergenic
979705724 4:123718018-123718040 TAAGGTGTAAGGAAGGAGTGTGG - Intergenic
979871918 4:125834183-125834205 TAAGGTCTAAGGCAAGAGCCTGG - Intergenic
980456730 4:133053985-133054007 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
980531767 4:134065795-134065817 TATGGTGTAAGGAAGGGATCCGG + Intergenic
980707178 4:136514015-136514037 GAGGGTATTAGGAATGGGCCTGG - Intergenic
980803989 4:137788607-137788629 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
981068800 4:140513158-140513180 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
981069426 4:140519378-140519400 TGAGGTGTAAGGAAGGGATCCGG - Intergenic
981809926 4:148762255-148762277 TAAGATGTAAGGAAAGGGTCTGG + Intergenic
982295115 4:153820183-153820205 TAAGGTGTAAGGAAAGAGTCCGG - Intergenic
982994900 4:162330629-162330651 TATGGTGTAAGGAAGGGGTTCGG + Intergenic
983276068 4:165619433-165619455 TAAGGTATAAGGAAGGGGTCTGG - Intergenic
984245837 4:177274661-177274683 TAAAGAATAAAAAAGGGGCCAGG + Intergenic
984286138 4:177731016-177731038 AAAGATATAAGAAAGGGGCACGG - Intronic
984590262 4:181609120-181609142 TAGGGAGTAAGGCAGGGGCCAGG + Intergenic
984625678 4:182005246-182005268 TAAGATGTAAGGAAGGGGTCCGG + Intergenic
984781907 4:183533790-183533812 TAAGAGATGAGGCAGGGGCCGGG - Intergenic
985112723 4:186562667-186562689 TAAAGCAAAAGGAAGAGGCCGGG - Intergenic
985317874 4:188677678-188677700 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
986620815 5:9672104-9672126 TATGATGTAAGGAAGGGGTCCGG - Intronic
987544459 5:19294858-19294880 CAATTTATAAGGAAGGAGCCAGG - Intergenic
987584128 5:19832705-19832727 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
987926015 5:24342869-24342891 CAAGATATAAAGATGGGGCCGGG + Intergenic
988351852 5:30118724-30118746 AAAGGAATAAGGATGGGGTCTGG - Intergenic
988406757 5:30833893-30833915 TAAGGTATAAAGAAGGGATCTGG - Intergenic
988489999 5:31698197-31698219 TAAGAAATAAGGAAGGGGCCGGG - Intronic
988867268 5:35349210-35349232 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
989734056 5:44681533-44681555 TATGGTGTAAGGAAGGGTTCTGG - Intergenic
990127660 5:52538186-52538208 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
990151201 5:52819825-52819847 TAAGGTGTAAGGAAGGGATCCGG + Intronic
990963473 5:61419115-61419137 TAAGTTATAAAGAGGAGGCCGGG - Intronic
991012530 5:61898970-61898992 GAAGGTAGAGGGAAGGGGGCTGG + Intergenic
991110290 5:62892055-62892077 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
992603980 5:78436401-78436423 TAAGGTATAAGGAAGGGATCCGG + Intronic
992634528 5:78714697-78714719 TAAGATGTAAGGAAGGGATCTGG - Intronic
994241427 5:97425795-97425817 TAAGGTATAAGGAACGGGGATGG + Intergenic
994409125 5:99384071-99384093 TATGGTCTAAGGAAGGGGTCCGG - Intergenic
994418381 5:99502590-99502612 TAAGGTATAAGAAAAGGATCCGG - Intergenic
994461588 5:100072558-100072580 TAAGGTATAAGAAAAGGATCCGG + Intergenic
994602433 5:101923619-101923641 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
994779809 5:104075536-104075558 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
995262815 5:110125088-110125110 TAAGGTGTAAGAAAAGGGTCTGG + Intergenic
995309753 5:110697261-110697283 TAAGGTGTAAGGAAGGGATCTGG - Intronic
995507920 5:112879769-112879791 TAAAGTATATGGAAGAGGCCGGG - Intronic
996778064 5:127154556-127154578 TGTGGTGTAAGGAAGGGGTCCGG + Intergenic
997369073 5:133345600-133345622 CAAGGTGTAAGGAAGGAGTCCGG + Intronic
998511843 5:142720339-142720361 TAAGGCAGGAGGAAGGAGCCTGG + Intergenic
998724000 5:144988096-144988118 TAAGTTGTAAGGAAGGGGTCCGG - Intergenic
998776150 5:145605350-145605372 TACGGTGTAAGGAAGGGGTCAGG + Intronic
999082158 5:148854963-148854985 TAGAGTGTGAGGAAGGGGCCTGG + Intergenic
999157571 5:149469432-149469454 AAAGGTGTAAAGAGGGGGCCAGG + Intergenic
999202003 5:149823233-149823255 TGAGGAATGAGGAAGGGGCGTGG + Intronic
999489387 5:152034482-152034504 TAAGGTATAAGGAAGGGGTCCGG + Intergenic
1000279598 5:159770956-159770978 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1000561163 5:162791172-162791194 CAAGGTGTAAGAAAGGGGTCCGG + Intergenic
1000769547 5:165335658-165335680 TAAGCTGTAATGAAGGGTCCTGG - Intergenic
1000786806 5:165555057-165555079 TATAGTGTAAGGAAGGGGTCCGG - Intergenic
1000994870 5:167948481-167948503 GGAGGTATAAGTAAGGTGCCTGG - Intronic
1001948547 5:175799828-175799850 GAAAGTATATGGAAGGGGCTGGG - Intronic
1002007496 5:176247784-176247806 TAAGGTGTAAGGAAGGGGCCCGG + Intronic
1002586208 5:180250316-180250338 TAAGGCCTGAGGAAGGGGCTAGG - Intronic
1002959508 6:1900988-1901010 AAATGTATTAGGAAGTGGCCTGG - Intronic
1003789040 6:9521861-9521883 TAATGTATAAGGCAGGGGAGGGG - Intergenic
1004352248 6:14900427-14900449 TAAGGCGTAAGGAAGGGGTCCGG - Intergenic
1005427722 6:25720928-25720950 TAAAGTTTAGGGAAGAGGCCGGG + Intergenic
1006706218 6:36023819-36023841 AAAGGTATAAGCAAAGAGCCTGG + Intronic
1007687062 6:43673317-43673339 TAAGGTAAAGGGAGGGGACCAGG + Intronic
1008164791 6:48123025-48123047 TATGGTGTAAGGAAGGGGTCTGG + Intergenic
1008293611 6:49750521-49750543 TATGGTGTAAGGAAGGGGTCTGG + Intergenic
1009028200 6:58025124-58025146 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1009264559 6:61536721-61536743 TAAAGTGTAAGGAAGGGGTCCGG - Intergenic
1009355457 6:62739431-62739453 TAAGATGTAAGGAAGGGATCCGG + Intergenic
1009804773 6:68589576-68589598 TATGGTAAAAGGAAAGAGCCTGG + Intergenic
1009855344 6:69255880-69255902 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1010540185 6:77083653-77083675 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1011105239 6:83772466-83772488 TATGGTATCAGGAAAGGGTCTGG + Intergenic
1011222605 6:85071161-85071183 TAAAGTGTAAGAAAGGGGGCCGG - Intergenic
1011235912 6:85216761-85216783 TAAGGTGTAAGGAAGGAGTCCGG - Intergenic
1011483405 6:87817739-87817761 TAAGGTGTAAGGAAAGGAACAGG + Intergenic
1012148930 6:95721095-95721117 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1012193684 6:96313040-96313062 AAAGGTAAAGGGAAGGGGCAGGG + Intergenic
1012801324 6:103833004-103833026 TACAGTGTAAGGAAGGGGTCTGG - Intergenic
1012814041 6:103999360-103999382 CATGGTGTAAGGAAGGGGTCCGG - Intergenic
1014004643 6:116404093-116404115 TAAGGTATAGGGAGGCTGCCTGG - Intronic
1014039833 6:116813571-116813593 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1014070820 6:117179801-117179823 TAAGGTGTAGGGAAGGGGTCCGG - Intergenic
1014367455 6:120562530-120562552 TATGGTGTAAGGAAAGGGTCCGG + Intergenic
1015641654 6:135340074-135340096 AAAGAAAAAAGGAAGGGGCCAGG + Intronic
1016238019 6:141891169-141891191 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1016604882 6:145908927-145908949 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
1016730853 6:147426111-147426133 TAAGGTATAAGAAAGGGGTCTGG + Intergenic
1017302792 6:152882115-152882137 TAAGGTGTAAGGAAGGGATCTGG - Intergenic
1017729768 6:157305138-157305160 GAAGGAATAAGGAAGAGGCCGGG + Intronic
1017836054 6:158179023-158179045 TAAGGTGTAAGGAAAGGGTCCGG + Intronic
1019984587 7:4646459-4646481 TATGTTATATGGAAGGGGCAAGG + Intergenic
1020519138 7:9164554-9164576 TAAAGTGTAAGGAAAGGGTCTGG + Intergenic
1020694548 7:11397374-11397396 TAAGGTGTAAGGAAGGGGTCCGG - Intronic
1021015120 7:15522659-15522681 TAAGGTGTAAGGAAGGGGTCCGG - Intronic
1021112209 7:16708272-16708294 TTAGATATATGGAAGGGGGCAGG - Intergenic
1021492776 7:21237449-21237471 TAATGTAAAAGAAAGAGGCCAGG - Intergenic
1021776811 7:24062357-24062379 TAAGGTATAAGGAAAAGGTCCGG - Intergenic
1021826763 7:24561230-24561252 TGAGGAATGAGGAAGGGGTCTGG - Intergenic
1021991519 7:26145982-26146004 CAAGGTATGGGGAAGGGGCACGG - Intergenic
1022058384 7:26765646-26765668 TAATGTGTAAGGAAGGGGTCCGG + Intronic
1022500190 7:30877973-30877995 TAAAGAAGAGGGAAGGGGCCAGG - Intronic
1023954674 7:44874853-44874875 TAAGGTATAAAGAAGGGAAAAGG - Intergenic
1024085156 7:45886500-45886522 TAAAGAATAACCAAGGGGCCAGG - Intergenic
1025160240 7:56652799-56652821 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1027125240 7:75552184-75552206 TAAGATACAAGGATAGGGCCAGG - Intronic
1027506667 7:79024296-79024318 TATGGTGTAAGGAAGGGGTCCGG - Intronic
1028411115 7:90531167-90531189 TAAAGTATATGGGAGGGGCTGGG - Intronic
1030012106 7:105180389-105180411 TATGGTGTAAGGAAGGGGTGCGG - Intronic
1031680852 7:124673063-124673085 AAAGGTACAAGGAAGGAGGCAGG - Intergenic
1031784335 7:126009926-126009948 TAAGGTGTAAAGAAGGGATCTGG + Intergenic
1031937701 7:127752556-127752578 AAAAGTATAATGCAGGGGCCAGG + Intronic
1032778771 7:135144618-135144640 TAAAGAATAAGAAAGAGGCCAGG + Intronic
1033102471 7:138486514-138486536 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1033836361 7:145316995-145317017 TAAGGTGTAAGGAAGGAGTCCGG - Intergenic
1034530117 7:151690365-151690387 TGAGGTATCTGGAAGGGGGCAGG - Intronic
1034595395 7:152185050-152185072 TAAAGTATACAGGAGGGGCCAGG - Intronic
1034893267 7:154858895-154858917 GTTGGTACAAGGAAGGGGCCTGG - Intronic
1039084410 8:33765711-33765733 TATGGTGTGAGGTAGGGGCCAGG - Intergenic
1039931424 8:41994109-41994131 TAAGGTATAAGAAAGAAGCTTGG - Intronic
1040426969 8:47298631-47298653 TAAGGTGTAAGGAAGGGATCTGG + Intronic
1041094921 8:54340425-54340447 TAAAGTATATGGGAAGGGCCAGG - Intergenic
1041747166 8:61220336-61220358 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
1042182569 8:66106218-66106240 TAAGGCAAAAGGAAGGGGAAGGG - Intergenic
1042664306 8:71189494-71189516 AACGGAAGAAGGAAGGGGCCAGG - Intergenic
1042764944 8:72310856-72310878 TAAGGTGTAAGGAAGGCATCTGG + Intergenic
1043324976 8:79038885-79038907 TATGGTGTAAGGAAGGGATCCGG - Intergenic
1043646780 8:82531244-82531266 TAAGATGTAATGAAGGGGTCCGG + Intergenic
1043774109 8:84243017-84243039 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
1044176989 8:89138378-89138400 TAAGGTGTAAGGAAGATGTCTGG + Intergenic
1044508980 8:93053461-93053483 AAAGGTATAAGGAAGGGGTCTGG + Intergenic
1044736942 8:95288569-95288591 TAACATATAAGGAAGGGGTCCGG + Intergenic
1045660200 8:104429248-104429270 TAAGGTGTAATGAAGAGCCCTGG + Intronic
1045706702 8:104931669-104931691 AAAGGCAGAAGGAAGGGGCCAGG + Intronic
1045969016 8:108058811-108058833 TAAGGTGTAACGAAGGGATCCGG - Intronic
1046279519 8:112007331-112007353 TATGGTATAATGAAGGGGTCTGG + Intergenic
1046434327 8:114167565-114167587 TAAGGTGTGAGGAAGGGATCCGG - Intergenic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1046979696 8:120323594-120323616 TATGGTATAAGGAAGGGGTCCGG + Intronic
1047655863 8:126976259-126976281 GAAAGTATAAGGAAGAGACCTGG - Intergenic
1048134325 8:131732764-131732786 CAAAGTATAAAGAAGGGGCCAGG + Intergenic
1048669256 8:136697633-136697655 TATGGTGTAAGAAAGGGGTCTGG + Intergenic
1048897697 8:139007875-139007897 TCTGTTTTAAGGAAGGGGCCAGG + Intergenic
1049899460 9:144509-144531 TAAGGTGTAAGGAAGGGATCTGG - Intronic
1052596830 9:30572271-30572293 TAAGATGTAAGGAAGGGGTCCGG - Intergenic
1052798323 9:32944706-32944728 TAAAGTATATGGGAGGGGGCTGG + Intergenic
1053222171 9:36321260-36321282 TATGATATAAGGAAGGGGTCTGG - Intergenic
1054347784 9:63984632-63984654 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1054445508 9:65310976-65310998 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1054484761 9:65710532-65710554 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1055836766 9:80453075-80453097 TAAGGTGTAAGGAAGGTGTAAGG - Intergenic
1055895271 9:81167400-81167422 TAAGGTGTAAGGAAGGGATCTGG - Intergenic
1056603073 9:88061630-88061652 TAAGGAGTAGGGAAGGGGCCAGG - Intergenic
1057030558 9:91772089-91772111 AATCATATAAGGAAGGGGCCAGG + Intronic
1058095913 9:100860294-100860316 TATGGTGAAAGGAAGGGGTCTGG + Intergenic
1058183001 9:101820787-101820809 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1058319087 9:103607455-103607477 TAAGGTGTAATGAAGGGATCCGG + Intergenic
1058511999 9:105729258-105729280 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1059089530 9:111341052-111341074 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1059402984 9:114082069-114082091 CCAGGAAGAAGGAAGGGGCCGGG + Intergenic
1059454406 9:114390418-114390440 TAAGGGAAAAGGAAGTGTCCAGG - Intronic
1059688109 9:116657295-116657317 TGAGGATTAAGTAAGGGGCCTGG + Intronic
1060596278 9:124851039-124851061 TAGGGTATAAGAAATGGGGCAGG + Intergenic
1060933295 9:127502387-127502409 TAAAGAATAATGAAGGGGGCCGG + Intronic
1061521737 9:131122269-131122291 TAAGGCATGAGGAAATGGCCAGG + Exonic
1186976039 X:14905785-14905807 TAAAGTATATAGGAGGGGCCAGG - Intronic
1187494256 X:19780621-19780643 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1187543881 X:20228257-20228279 TGAGGCATTAGGAAGTGGCCTGG + Intronic
1187902113 X:24035003-24035025 GAAAGTCCAAGGAAGGGGCCTGG - Intergenic
1187966667 X:24618916-24618938 TAAAGTATCAGAAAGGGGCCGGG - Intronic
1188155081 X:26731792-26731814 TAAGGTGTAAGGAAAGGGTGAGG + Intergenic
1188362386 X:29272083-29272105 CATGGTGTAAGGAAGGGGTCCGG + Intronic
1190374983 X:49780284-49780306 TAAGGTGTAAGGAAGGGATCAGG - Intergenic
1190629349 X:52369455-52369477 TAAGCGGTAAGAAAGGGGCCTGG + Intronic
1190650259 X:52562803-52562825 TGGGAGATAAGGAAGGGGCCTGG - Intergenic
1190901296 X:54676131-54676153 TGTGGTATAAGGAAGGGGTCTGG - Intergenic
1191071568 X:56406115-56406137 TAAGGTGTAAGGAAGGAGTCCGG + Intergenic
1191925623 X:66306689-66306711 TGAGGCATAAGGAAAGGGTCTGG + Intergenic
1191935097 X:66418953-66418975 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1192242045 X:69339941-69339963 TAAGGTGTAAGGAAGGGATCGGG + Intergenic
1192256008 X:69459715-69459737 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1192406950 X:70895835-70895857 TAAGGTGTAGGGAAGGGATCCGG - Intronic
1192921878 X:75715406-75715428 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1193051157 X:77101257-77101279 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1193072778 X:77323831-77323853 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1193340872 X:80347850-80347872 TAGTGTGTAAGGAAGGGGTCTGG + Intronic
1193359433 X:80562852-80562874 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1193381707 X:80823396-80823418 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
1193552096 X:82907134-82907156 TAAGGTGTAATGAAGGGGTCCGG - Intergenic
1193844447 X:86451235-86451257 TATGGTATAAGGAAGGGGCCTGG + Intronic
1194043232 X:88969884-88969906 TAAGATCTGGGGAAGGGGCCAGG - Intergenic
1194396390 X:93392505-93392527 TAAGGTGTAAGGAAAGGGTCCGG - Intergenic
1194462278 X:94186297-94186319 TAAGGTGTAAAAAATGGGCCAGG + Intergenic
1194555543 X:95354045-95354067 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1194852396 X:98885742-98885764 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
1195171244 X:102270727-102270749 TAAAGTGTAAGGAAGGGGTCTGG + Intergenic
1195187616 X:102416372-102416394 TAAAGTGTAAGGAAGGGGTCTGG - Intronic
1195601730 X:106756550-106756572 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1195639795 X:107160594-107160616 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1195767537 X:108312362-108312384 TAACGTATAAGGAAGGTGTTTGG - Intronic
1196100284 X:111840320-111840342 TAAAGTATATGGAATGGGCCAGG - Intronic
1196109678 X:111932572-111932594 TATGGTGAAAGGAAAGGGCCAGG - Intronic
1196528932 X:116760296-116760318 TATGGTGTAAGGAATGGGTCTGG - Intergenic
1197003891 X:121473107-121473129 TAAGGTATAAGGAAGGGATCCGG + Intergenic
1197418409 X:126205654-126205676 TATGGTATAAGAAAGGGGTCTGG + Intergenic
1197506450 X:127310753-127310775 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1198610358 X:138392909-138392931 TAAGGTGTAAGTAAGTGGTCCGG - Intergenic
1199079942 X:143565891-143565913 TAAGGTGTAAGGAAGGAGTCCGG - Intergenic
1199161532 X:144617787-144617809 TAAGGTATAAGGAAGGGGTCCGG + Intergenic
1199547601 X:149022916-149022938 TATGGTGTAAGGAAGGTGTCCGG - Intergenic
1199931316 X:152525912-152525934 GAAGGTATAATGAATGGGCTTGG - Intergenic
1201342543 Y:12950213-12950235 AAAGCTACAAGAAAGGGGCCAGG - Intergenic
1201352281 Y:13057030-13057052 TATGGTATAAAGAAGGGGACCGG + Intergenic
1201507135 Y:14714597-14714619 TAAGGTGTAAGGAAAGGGTCCGG - Intronic
1201522328 Y:14889020-14889042 TAAGGTGTAAAGAAGGGGTCCGG + Intergenic
1201676434 Y:16590519-16590541 TAAGGTGTAAGGAAGGGGACTGG - Intergenic
1201709049 Y:16969338-16969360 TAAGGTGGAAGGAAGGGGTCTGG + Intergenic
1201769399 Y:17604390-17604412 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1201832155 Y:18301595-18301617 TATGGTGTAAAGAAGGGGTCTGG + Intergenic
1202349876 Y:23977973-23977995 TAAGGAATAATGTATGGGCCAGG + Intergenic
1202520903 Y:25692146-25692168 TAAGGAATAATGTATGGGCCAGG - Intergenic
1202582682 Y:26398563-26398585 GAAAATATAATGAAGGGGCCGGG + Intergenic