ID: 1154387638

View in Genome Browser
Species Human (GRCh38)
Location 18:13909874-13909896
Sequence TACATTGAGCACTCTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154387638_1154387639 -9 Left 1154387638 18:13909874-13909896 CCAAGATCAGAGTGCTCAATGTA 0: 1
1: 0
2: 0
3: 2
4: 114
Right 1154387639 18:13909888-13909910 CTCAATGTACTTGTTGCTACTGG 0: 1
1: 0
2: 1
3: 9
4: 138
1154387638_1154387641 -7 Left 1154387638 18:13909874-13909896 CCAAGATCAGAGTGCTCAATGTA 0: 1
1: 0
2: 0
3: 2
4: 114
Right 1154387641 18:13909890-13909912 CAATGTACTTGTTGCTACTGGGG 0: 1
1: 0
2: 0
3: 27
4: 231
1154387638_1154387640 -8 Left 1154387638 18:13909874-13909896 CCAAGATCAGAGTGCTCAATGTA 0: 1
1: 0
2: 0
3: 2
4: 114
Right 1154387640 18:13909889-13909911 TCAATGTACTTGTTGCTACTGGG 0: 1
1: 0
2: 1
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154387638 Original CRISPR TACATTGAGCACTCTGATCT TGG (reversed) Intronic
908152694 1:61319883-61319905 TCTAATCAGCACTCTGATCTGGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
913204384 1:116523294-116523316 TGCATTGTGTACTCTGATTTTGG - Intronic
913714981 1:121524383-121524405 TATATTTAGCACCCAGATCTTGG + Intergenic
915515541 1:156410358-156410380 CACAATGAGCACCCTGATGTCGG - Intronic
916785350 1:168083133-168083155 TAAAGTGTGCACTCTGATTTAGG - Exonic
917354766 1:174115555-174115577 TACATTGTGCAGGCTGGTCTTGG + Intergenic
917384885 1:174461545-174461567 TACAGAGAGCACTCTGTACTTGG - Intronic
1066364624 10:34764857-34764879 TACTTTGAGCACTGTGTGCTGGG - Intronic
1068206224 10:53858198-53858220 TAAATTGAACACTCTGAGTTAGG + Intronic
1071541777 10:86491500-86491522 CACACTCAGCACTCAGATCTTGG + Intronic
1072804056 10:98413164-98413186 CACATTGAGCAACCTCATCTTGG + Intronic
1072966030 10:99973546-99973568 TGCTGTGAGCACTGTGATCTTGG - Intronic
1076438769 10:130464839-130464861 TACAAGGAGAACCCTGATCTTGG + Intergenic
1080293540 11:30698931-30698953 CACATGCAGCACTCAGATCTTGG + Intergenic
1081036995 11:38160942-38160964 TACATCTAGCACACAGATCTTGG + Intergenic
1081852673 11:46284730-46284752 TCCATTGTGCACTCTGCTCAAGG + Intronic
1086873095 11:92063153-92063175 TACATTGTGCAAGCTCATCTGGG + Intergenic
1087332996 11:96806484-96806506 TACATTGAAGATTCTGATATGGG - Intergenic
1090310110 11:125729087-125729109 TACAGTAAGCACTCAGCTCTTGG - Intergenic
1092097485 12:5855169-5855191 TTCATTCCGCCCTCTGATCTTGG + Intronic
1092943103 12:13428706-13428728 TTTATTGAGCAGTCTGAACTTGG - Intergenic
1095166032 12:38973104-38973126 CACACTTAGCACTCAGATCTTGG - Intergenic
1095701804 12:45198270-45198292 TACGTTTAGCACCCAGATCTTGG - Intergenic
1096147324 12:49288043-49288065 TTCACTGAGCACTCTGCCCTTGG + Intergenic
1100243088 12:92729418-92729440 TAGAGAGGGCACTCTGATCTAGG - Intronic
1101790186 12:107918981-107919003 TACAATAAGCACTTTGGTCTTGG + Intergenic
1102316103 12:111888963-111888985 TACACTGAGCAATCACATCTCGG - Exonic
1107071540 13:36275457-36275479 TCAATTGACCATTCTGATCTTGG + Intronic
1108785882 13:53900681-53900703 TACTTTCAGCTCTCTGAACTTGG - Intergenic
1110113015 13:71774674-71774696 TACAATGAGCACACTGACTTTGG - Intronic
1110710981 13:78650590-78650612 TTTATTGAGCAGTCTGACCTTGG + Intronic
1110762464 13:79245610-79245632 AACGTTGAGAACACTGATCTAGG + Intergenic
1118187821 14:63553608-63553630 TTCATTGAACACTATGAGCTAGG + Intergenic
1121171362 14:91857103-91857125 TACAATGAGGACTCTGAGGTTGG - Intronic
1122105893 14:99454614-99454636 TACAATGAGCACTGTGTGCTAGG + Intronic
1125308664 15:38353291-38353313 TACATTGTTCAGTTTGATCTGGG - Exonic
1126676949 15:51167836-51167858 TACATCTAGCACTTAGATCTTGG - Intergenic
1134672304 16:16064748-16064770 TTCACTGAGCACCATGATCTGGG + Intronic
1139098986 16:63743414-63743436 TTCATCCAGCACCCTGATCTTGG + Intergenic
1142947186 17:3439922-3439944 TACAGTGAGCATTTTTATCTAGG + Intergenic
1143198182 17:5092983-5093005 TACAGTGAACACTTTGATGTCGG - Exonic
1146454219 17:32996773-32996795 TGCAGTGAGCACCCTGGTCTGGG + Intronic
1151950023 17:77346957-77346979 GACACTGAGCACCCTGATTTTGG + Intronic
1153971078 18:10227908-10227930 TACATTTAAAACTTTGATCTTGG + Intergenic
1154387638 18:13909874-13909896 TACATTGAGCACTCTGATCTTGG - Intronic
1157316276 18:46592565-46592587 TAGATTGAGCTCCCGGATCTTGG - Intronic
1159154055 18:64558970-64558992 CACATTCAGCACTCAGCTCTTGG - Intergenic
1159739644 18:72151257-72151279 TACATTAAGGTCTGTGATCTAGG + Intergenic
1159912362 18:74158220-74158242 TACATTGAGGGCTCTGAGCCAGG + Exonic
1161032930 19:2067398-2067420 TACATTGCTCAGGCTGATCTTGG - Intergenic
1161528314 19:4771081-4771103 TACCCTGAGAACTCTGGTCTAGG - Intergenic
925199084 2:1951526-1951548 TTCATGGACCACTCAGATCTGGG - Intronic
925514930 2:4671159-4671181 AATATTGAGTACTCTGATGTTGG + Intergenic
927347456 2:22062343-22062365 TACATTCTGCATTCTGTTCTGGG + Intergenic
927848103 2:26481909-26481931 CACAGTGAGCACTTTGATCCAGG + Intronic
936277008 2:111107858-111107880 TCCATGGAGAACACTGATCTGGG - Intronic
937038209 2:118799947-118799969 TGGAGTGATCACTCTGATCTTGG + Intergenic
938028400 2:127970638-127970660 TACAGTGAGCGGTGTGATCTAGG - Intronic
938602108 2:132852991-132853013 TTCATTGAGCACTATGTCCTTGG - Intronic
947485612 2:230545955-230545977 TCCATTGAGCACTAAAATCTCGG + Intergenic
948953135 2:241267948-241267970 TACATTCAGCATTCTGAGGTAGG + Intronic
1169063377 20:2677743-2677765 TTCAATGAGTACACTGATCTGGG - Intergenic
1178152601 21:29812806-29812828 AAAATTTAGCACACTGATCTAGG - Intronic
1182255831 22:29037732-29037754 TTCATTCAGCACTCTGCACTGGG + Intronic
949100809 3:142798-142820 CACATTTAGCACACAGATCTTGG - Intergenic
952362744 3:32647134-32647156 TACATTGAGCAGTTTTAACTGGG - Intergenic
952877364 3:37957622-37957644 TACAGTGACTTCTCTGATCTCGG - Intronic
954791427 3:53136122-53136144 TCCATTCAGCACTCTGCGCTGGG + Intergenic
954876099 3:53804100-53804122 TACAATGGGCACTCTGCTTTAGG + Intronic
955116857 3:56014014-56014036 TACATTAGGCATTCTGATTTTGG + Intronic
955556307 3:60140900-60140922 AACACTGAGTACTCGGATCTAGG + Intronic
956479319 3:69658082-69658104 CACATTCAACACTCAGATCTTGG + Intergenic
957537106 3:81520480-81520502 TAGAAAGAGCACTCTGGTCTTGG + Intronic
958184464 3:90102736-90102758 TACATCGAGGACCCAGATCTTGG + Intergenic
959584076 3:108009492-108009514 TAGAATGAGGTCTCTGATCTGGG - Intergenic
973833453 4:54785261-54785283 TACAGTGAGCCATCTGACCTAGG + Intergenic
974019186 4:56677898-56677920 CACACTGGGCACTCTGTTCTGGG - Intronic
976561648 4:86508597-86508619 TTCTGTGAGCACTCTGATTTTGG + Intronic
981406778 4:144380305-144380327 TACATTGGGAATTCTGATTTAGG - Intergenic
986225554 5:5808598-5808620 TATATTGAGCCCTCCGATTTAGG + Intergenic
988465631 5:31488865-31488887 TACAGTGACCATTCTGATGTGGG + Intronic
991282314 5:64929251-64929273 TACATTTAGCACCCAGATCTTGG + Intronic
993815985 5:92546397-92546419 TTCATTGGGCACCCTGATCCAGG - Intergenic
996227969 5:121024692-121024714 TTCATTGAAAACTCTGAACTAGG + Intergenic
996524035 5:124458520-124458542 CACATTGGGCATTTTGATCTTGG - Intergenic
998261029 5:140632072-140632094 GAGATCGAGCACTCTGAGCTTGG + Exonic
998769035 5:145520823-145520845 TATATTGAGTACTATGTTCTCGG - Intronic
1010942583 6:81936127-81936149 TGCAATGAGCACTCTAACCTGGG - Intergenic
1022227593 7:28379737-28379759 AACATTGAGAATACTGATCTAGG + Intronic
1022922749 7:35033007-35033029 TACTTTGAGAAATCTGCTCTTGG - Intronic
1027795290 7:82685407-82685429 TTCATTAAGCACTATGACCTGGG + Intergenic
1027920396 7:84386225-84386247 TGCATTGAGCACTGAGATATGGG - Intronic
1028293131 7:89092887-89092909 TACATCTAGCACCCAGATCTTGG - Intronic
1030684098 7:112466017-112466039 TAGATTGATGATTCTGATCTAGG + Intronic
1032447521 7:131997411-131997433 TACATTGAGCACTATCACCCTGG + Intergenic
1033101208 7:138473970-138473992 TACATTGCTCAGTCTGGTCTTGG + Intronic
1039371612 8:36989720-36989742 TACACAGAGCACTCAGATCTTGG - Intergenic
1041486817 8:58386764-58386786 TACATAGACCGCTCTGCTCTTGG + Intergenic
1043755096 8:83993716-83993738 TATATTTAGCACTCTCATTTAGG + Intergenic
1044406067 8:91827670-91827692 TACAATGAGGAAACTGATCTTGG + Intergenic
1045373472 8:101548682-101548704 TAAACTGAGAACTCTGAACTTGG - Intronic
1047353776 8:124100690-124100712 TACACTGAGGACTCTGAAATTGG - Intronic
1047424526 8:124733366-124733388 AACATTAAGAACACTGATCTAGG - Intergenic
1047583797 8:126246434-126246456 TACATTCAGCACCCAGGTCTTGG - Intergenic
1047846443 8:128810909-128810931 CACACTTAGCACTCAGATCTTGG + Intergenic
1050074900 9:1853208-1853230 GACATCTTGCACTCTGATCTTGG + Intergenic
1050632931 9:7579795-7579817 CACATTGAGCACAGGGATCTTGG + Intergenic
1051534831 9:18144767-18144789 TACATGGACCCCTCTGAGCTGGG - Intergenic
1051676909 9:19567738-19567760 AACACTGAGAAATCTGATCTGGG - Intronic
1052202560 9:25800466-25800488 TAGATTCAGCACTTTGATCAAGG - Intergenic
1056452735 9:86732546-86732568 TAAATTAAGGCCTCTGATCTTGG + Intergenic
1058349815 9:104008804-104008826 TAAATTGAGCACACAGGTCTTGG + Intergenic
1058375219 9:104315047-104315069 TACCCTGAGCAGTCTCATCTGGG + Intergenic
1059315339 9:113420590-113420612 TTCCTTGAGCACTATGTTCTAGG + Intronic
1192967997 X:76200630-76200652 TTCATTTAGTTCTCTGATCTTGG + Intergenic
1196981469 X:121218734-121218756 TACTTATAGCTCTCTGATCTTGG + Intergenic