ID: 1154387973

View in Genome Browser
Species Human (GRCh38)
Location 18:13912658-13912680
Sequence TCTACGTTGTTTTCTGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154387973 Original CRISPR TCTACGTTGTTTTCTGCTCC CGG Intronic
903283877 1:22265162-22265184 TCTCCCTTGTAATCTGCTCCTGG - Intergenic
904672053 1:32173353-32173375 TCTACTTTGGCTTCAGCTCCGGG + Exonic
907710611 1:56877155-56877177 TCAAGGTTGTTTTCTGCTGGAGG - Intronic
908087271 1:60649237-60649259 CCTAGGTTGTCTTCAGCTCCTGG - Intergenic
909187977 1:72513786-72513808 TCTATGTTGTTTTCTTTTCCTGG + Intergenic
911682850 1:100738119-100738141 TCTTTGTTGTTTTCTCTTCCTGG - Exonic
912549952 1:110479143-110479165 TTGACTTTGATTTCTGCTCCCGG + Intergenic
912584342 1:110748821-110748843 CCTATTTTGTTTTCTTCTCCAGG + Intergenic
914385620 1:147167060-147167082 TATACGTTGTTTTTTACACCAGG - Intronic
917940358 1:179913858-179913880 TCTACTTTTTCTTCTGCTTCTGG + Intronic
918406738 1:184218887-184218909 TCTCCTTTGTTTCCTTCTCCTGG + Intergenic
918774632 1:188611709-188611731 TCAATGTTGGTTTCTGCTGCTGG - Intergenic
920197568 1:204239318-204239340 TCAATGTTGGTTTCTGCTGCTGG - Intronic
922098492 1:222462484-222462506 TCCACGTGGTTTTCTGCTGAGGG + Intergenic
922931762 1:229395631-229395653 TCTTCGTTTTCTTCTGGTCCAGG + Intergenic
923481599 1:234390148-234390170 TCCACTCTGTTTTCTGCCCCAGG - Intergenic
923863702 1:237917483-237917505 TCTACCCCTTTTTCTGCTCCTGG + Intergenic
1064517453 10:16166840-16166862 TCAGCGTTGCTTTCTGCTGCTGG + Intergenic
1064703819 10:18049823-18049845 CCTGCAGTGTTTTCTGCTCCTGG - Intergenic
1067059206 10:43069292-43069314 TCTTCATTGTTGTCTGTTCCTGG - Intergenic
1067164406 10:43853753-43853775 TGTAGGCTGTTTTCAGCTCCAGG - Intergenic
1067442924 10:46321368-46321390 TCTAGGATGTTGTCTGCTTCTGG + Intronic
1067513403 10:46914321-46914343 TCTGAGTTGTTGTCTGCTCCTGG - Intronic
1067648849 10:48137521-48137543 TCTGAGTTGTTGTCTGCTCCTGG + Intergenic
1068182960 10:53546103-53546125 TCTAGGTTGTTTCCTGATACCGG + Intergenic
1070479452 10:76868080-76868102 TCTACTTTGATTTTTGCTACAGG + Intergenic
1071100155 10:82027406-82027428 TCTGAGTTTTTTTCTTCTCCAGG + Intronic
1073263337 10:102207286-102207308 TCTTCCTTGCTTTGTGCTCCAGG + Intergenic
1074847460 10:117410805-117410827 CCCACGTTGATTCCTGCTCCTGG - Intergenic
1076710072 10:132328287-132328309 TCCTTGCTGTTTTCTGCTCCTGG + Intronic
1078089093 11:8252817-8252839 TTTACTTGGTTCTCTGCTCCGGG - Intronic
1079940623 11:26675721-26675743 TCTAGGTTGCATTCTGCTCATGG - Intronic
1080004153 11:27387545-27387567 ACTAAGTTGGTTTCTGCTACTGG - Intronic
1087748270 11:101975083-101975105 TCTATGTTGTTTTCTATTCTTGG - Intronic
1088097344 11:106116092-106116114 TCAGCGTTGTTCTCTGCTGCTGG - Intergenic
1090451866 11:126813377-126813399 TCCTCGTAGTTTGCTGCTCCTGG + Intronic
1090785305 11:130042985-130043007 TCTAGGTTCCTTTCTCCTCCGGG - Intergenic
1093812107 12:23503952-23503974 TCTACCTTCTGTTCTGCTCCTGG - Intergenic
1094341486 12:29416883-29416905 TCTAGGTTGTTTCCAGCTCTGGG - Intronic
1097090236 12:56499002-56499024 TCTACCTCTTTTTCTGCTCCTGG - Intergenic
1099042209 12:77669924-77669946 TCTTCGTTCTTTTCTTCTGCTGG - Intergenic
1099333499 12:81322899-81322921 TTTTCTTTGTTTTCTGATCCAGG - Intronic
1106229663 13:27812141-27812163 CCTACGTGGCTTCCTGCTCCTGG - Intergenic
1110463492 13:75774015-75774037 TCTATGCTGTTTTCTTCTCTAGG + Intronic
1111415923 13:87943918-87943940 TTTAAGTGGTTTTCTGCCCCGGG + Intergenic
1113010884 13:105764534-105764556 TCCAGGTTTTCTTCTGCTCCTGG + Intergenic
1113748962 13:112765346-112765368 CCTGCCTTGTTTTCTGGTCCTGG + Intronic
1114831067 14:26142146-26142168 TCTACCTTGCTGTCTGCTGCAGG - Intergenic
1115652464 14:35412751-35412773 TCTCCCTTTTTTTCTGCTCATGG - Intergenic
1116462934 14:45198430-45198452 TCTACGTTGATTCCAGCTCAAGG + Intronic
1117503233 14:56374854-56374876 TTAGCCTTGTTTTCTGCTCCTGG + Intergenic
1117924053 14:60757778-60757800 TTTAGGTTTTTTTCTGCTCTTGG + Intronic
1122394950 14:101418828-101418850 TCTCTGTAGTTTTCTGCTCGAGG - Intergenic
1126495266 15:49283094-49283116 TCCATGTTGTTTTTTGCCCCTGG + Intronic
1126535777 15:49762360-49762382 TTTACATTATTTTCAGCTCCTGG + Intergenic
1132967712 16:2668258-2668280 TCTACCTCTTTTTCTGCTCCTGG - Intergenic
1133357332 16:5146236-5146258 TCTACATTGTTTTCTGAGCCTGG - Intergenic
1134390662 16:13816995-13817017 TCTGTTTTGTTTTCTGCTCTGGG - Intergenic
1136669337 16:31842036-31842058 TCTACTTTGTTTTCTTCTAGTGG - Intergenic
1139112838 16:63912826-63912848 TCTTCCTTTTTTTCTTCTCCTGG - Intergenic
1139785955 16:69392134-69392156 GCTACGTTGTTTTGAACTCCTGG - Intronic
1140923692 16:79562868-79562890 TCTACTCTGTTTTCTGGACCTGG - Intergenic
1141314191 16:82945086-82945108 TCTACACTGTTTTCTCCTCATGG - Intronic
1147399069 17:40168307-40168329 CCTACTTACTTTTCTGCTCCAGG + Exonic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1154387973 18:13912658-13912680 TCTACGTTGTTTTCTGCTCCCGG + Intronic
1156830308 18:41483888-41483910 TCTATGTGGTTTTGTGCTACGGG - Intergenic
1157743067 18:50110256-50110278 TCTGCTTTATTTTCTTCTCCTGG + Intronic
1160019100 18:75166674-75166696 ACTTCCTTGCTTTCTGCTCCAGG - Intergenic
1160763141 19:795861-795883 TTTAGGGTGTTTTCTGCTGCTGG + Intergenic
1164084404 19:21888240-21888262 TCTACCTCTTTTTCTGCTCCTGG - Intergenic
1164262136 19:23577139-23577161 TCTAAGTGGTTTTCTGCCCTAGG + Intronic
925612025 2:5709515-5709537 TGTACGTTGTTTGCTCTTCCTGG + Intergenic
925802800 2:7618139-7618161 TCTAAGCTGCTTTGTGCTCCAGG - Intergenic
928694743 2:33837933-33837955 TCTACATTGTTTTATGATGCTGG + Intergenic
929423959 2:41825029-41825051 TCTAGGTTGTTTTCAGTTCCGGG - Intergenic
935456910 2:103280549-103280571 ACTTCCTTGTTTTCTGTTCCAGG - Intergenic
941386868 2:164863765-164863787 AGTATGTTGTTTTCTGCTCAAGG - Intergenic
942055760 2:172180732-172180754 TCTGCGTTGCTTTCTCCTCATGG + Intergenic
942475966 2:176321137-176321159 TCTTCCTTGTTTTCAGATCCAGG + Intronic
944746754 2:202664937-202664959 TCCACTGTGTTTTCTGCTCAGGG + Intronic
945077177 2:206051391-206051413 TCTCCTTTGTTTTTTGCTTCCGG - Intronic
945459922 2:210094041-210094063 TCTTCCTTGCTTTCAGCTCCTGG - Intronic
946004081 2:216508021-216508043 TCTATCTTGATCTCTGCTCCAGG - Intronic
1168989943 20:2086494-2086516 TCTGCGTTTTTCTATGCTCCTGG - Intergenic
1173717823 20:45225074-45225096 TCTATGTTGGCTTCTTCTCCTGG - Intergenic
1174984704 20:55437761-55437783 TCCATATTGTTTTCTGCTCCTGG - Intergenic
1175036812 20:56007056-56007078 TCTACCTCCTTTTCTTCTCCAGG + Intergenic
1175871002 20:62209475-62209497 TCTTCCTTGCTGTCTGCTCCAGG + Intergenic
1177451466 21:21273322-21273344 TCTTCTTTGTTTTCTTCTCTTGG - Intronic
1177971897 21:27800330-27800352 TCATTGTTTTTTTCTGCTCCAGG - Intergenic
1178223880 21:30692127-30692149 TCTACTTTATTTTCTTTTCCTGG + Intergenic
1182052300 22:27322853-27322875 TCTTCTTTGTTTTCTGATGCTGG - Intergenic
1182203169 22:28594507-28594529 TCAACCTTTTTTTCTGCCCCAGG - Intronic
1183527597 22:38333113-38333135 TCTCTGTTGTTTTCTGCACAAGG - Intronic
1184194858 22:42920659-42920681 TTTAGGTGGTTTTCTTCTCCTGG - Intronic
949439790 3:4067851-4067873 TCTACCTTGTTCTGTGCTCTGGG - Intronic
949470362 3:4389557-4389579 TCTTCTTTGTTTTCTCCTCTGGG + Intronic
950192149 3:10984623-10984645 ACTGGATTGTTTTCTGCTCCAGG - Intergenic
950269943 3:11605675-11605697 CCTACTTTATTTTGTGCTCCTGG + Intronic
951715384 3:25638245-25638267 TCTACCTTGTGTTCTACTACTGG + Exonic
953057952 3:39403346-39403368 TCTAAGTTCTTCTCTGCTCCTGG + Intergenic
953750697 3:45606412-45606434 TCTGCCTTCTTTGCTGCTCCTGG - Intronic
954197701 3:49006286-49006308 TCCAAATAGTTTTCTGCTCCTGG + Intronic
957875882 3:86146217-86146239 TCCAAGTTCTTTCCTGCTCCAGG - Intergenic
961786239 3:129348730-129348752 TCTCCTCTGTTTTCTCCTCCTGG - Intergenic
962450982 3:135516790-135516812 TCTACCAGATTTTCTGCTCCGGG - Intergenic
964447612 3:156776576-156776598 TCTACCTTGTTTTGTGATGCTGG - Intergenic
965751163 3:171976314-171976336 TCTACATTTTTTTCTGTTCCTGG - Intergenic
966090997 3:176136020-176136042 TCTACCTTATTTTCTACTTCAGG + Intergenic
970086779 4:12356899-12356921 TCTACGTTGTAGTCTTCTCCAGG - Intergenic
970162463 4:13202799-13202821 TCCACTGTGTTTTCTGCTCACGG + Intergenic
971811533 4:31434015-31434037 TCTGTGTTATCTTCTGCTCCTGG - Intergenic
972093339 4:35316814-35316836 TCAACATTGTTCTCTGCTGCTGG - Intergenic
973386498 4:49517379-49517401 TCTATTTTGTTCTCTGCCCCAGG + Intergenic
973553570 4:52059256-52059278 TGTACGCTGTTTTCTGTTCTGGG + Intronic
975877039 4:78853482-78853504 TCTAAGTTCTTTTCAACTCCTGG - Intronic
977149163 4:93487735-93487757 TCTGGGTTATTTTCTTCTCCAGG + Intronic
983616769 4:169715052-169715074 TTCAAGTTGTTTTCTGTTCCTGG + Intronic
985329773 4:188818360-188818382 TCTTCGTTGTTTTATTGTCCTGG - Intergenic
986462851 5:7990955-7990977 CCTAAGTTGTTTTTTGCTTCTGG - Intergenic
987575268 5:19719821-19719843 TCTACGTTGTTTTCTTTTTAAGG + Intronic
988677220 5:33444799-33444821 ACTACTGTGTTTTCTCCTCCGGG + Intronic
989020414 5:36999057-36999079 TCTAGGTTGGTTTCTGGTTCTGG - Intronic
989353595 5:40516256-40516278 TCAACATTGATTTCTGCTGCTGG - Intergenic
992426947 5:76667626-76667648 TCTTTGTTGTTTTTTGCTCATGG + Intronic
993876769 5:93316596-93316618 TCTCCGTTGTTATTGGCTCCAGG + Intergenic
994639671 5:102391429-102391451 TCTACCTTGCTTTCTGCCCCGGG + Intronic
995088366 5:108141777-108141799 TATACGTTGTTCTGTGCCCCAGG + Intronic
996123106 5:119693115-119693137 TCTCATTTGTTTTCTGCCCCAGG - Intergenic
998646958 5:144072679-144072701 TCTACTTTGTTTCATGCTTCAGG - Intergenic
1001495762 5:172187108-172187130 AGGACGTTGGTTTCTGCTCCTGG - Intronic
1006946906 6:37790744-37790766 TCTTGTTTGTTTTCTGCTCAAGG + Intergenic
1007768298 6:44174227-44174249 TCTAGGTTGTTTCCTGTTTCGGG - Intronic
1009380302 6:63020031-63020053 ACTACTTTTGTTTCTGCTCCAGG - Intergenic
1013379439 6:109552815-109552837 TCTACGTTTTTTTATGCTTTTGG + Intronic
1013748103 6:113369109-113369131 TATAAGTTGTTCTCTGCCCCAGG + Intergenic
1014367089 6:120557542-120557564 TCTATGGTATTTTCTGCTTCTGG - Intergenic
1015658280 6:135544607-135544629 TCTCTTTTGTTTTCTGCTACAGG + Intergenic
1016060925 6:139628996-139629018 TCAACCTTGTTCTCTGCTCAGGG + Intergenic
1016700907 6:147053193-147053215 TCAACTTTGTTTTCTGCTAAGGG - Intergenic
1017353100 6:153467702-153467724 TTTACGTGTTTTTCTGTTCCTGG + Intergenic
1019029860 6:169000720-169000742 ACCACTTTGTTTTCTGCTCTAGG - Intergenic
1020768787 7:12360351-12360373 TCAAGATTGTTTTCTCCTCCTGG - Intronic
1021197450 7:17688954-17688976 ACTACGTTGTCCTCTGTTCCTGG - Intergenic
1021423990 7:20478153-20478175 TATCAGTTGTTTTCTGCTCATGG - Intergenic
1023305894 7:38826494-38826516 TCTTCCTGTTTTTCTGCTCCAGG - Intronic
1023361837 7:39425050-39425072 TCTACGAGGTTTGCTGCTCATGG + Intronic
1027545558 7:79523742-79523764 TCTACATTTTTGTTTGCTCCTGG - Intergenic
1027919466 7:84374097-84374119 TTTACATTGTTTTCTCCTCTGGG - Intronic
1028474641 7:91239903-91239925 TCTGCTTTGCTTTCTGCACCTGG + Intergenic
1031084756 7:117291497-117291519 TCTACTCTGGTTACTGCTCCAGG - Intronic
1032605026 7:133341049-133341071 TCTTGGTTGTTTTCTGCAGCTGG + Intronic
1034213854 7:149388077-149388099 TTTAAGTTTTCTTCTGCTCCTGG + Intergenic
1035004877 7:155649091-155649113 GCTACTTTGTTTTCTCCTTCTGG + Intronic
1035788832 8:2285222-2285244 TCTAGGTCATTTTCTGATCCAGG + Intergenic
1035803973 8:2436483-2436505 TCTAGGTCATTTTCTGATCCAGG - Intergenic
1038826551 8:31008970-31008992 TCATTGTTGTTTTCTTCTCCCGG + Intronic
1039353245 8:36785761-36785783 TCTTCTTAGTCTTCTGCTCCAGG + Intronic
1045304284 8:100944376-100944398 TCTACGTTTTTATTTGCTCAGGG - Intronic
1048273256 8:133046177-133046199 TCTTGGGTGTTTTCTACTCCTGG - Intronic
1048457037 8:134587617-134587639 TCAACTTTGTTTTCTCCCCCTGG - Intronic
1048980054 8:139698384-139698406 AATACTATGTTTTCTGCTCCAGG - Intronic
1049344119 8:142129352-142129374 TGTGCGTTGTTTCCTGTTCCGGG - Intergenic
1050241785 9:3644082-3644104 TATATTTTGTTATCTGCTCCTGG - Intergenic
1050241860 9:3644972-3644994 TATATTTTGTTATCTGCTCCTGG - Intergenic
1050668679 9:7971035-7971057 TCTACGTTGTTCTGGGCTCAAGG + Intergenic
1051788764 9:20775778-20775800 TCCAGGTTGTTTTCTGTTACTGG + Intronic
1056592145 9:87972432-87972454 TCTGCCTTGTTCTGTGCTCCTGG + Intronic
1056921787 9:90797181-90797203 TCTACTTTGTTTTTTCTTCCTGG - Intergenic
1060229565 9:121816840-121816862 TCTAAATTTTTTTCTGTTCCTGG - Intergenic
1060268080 9:122123696-122123718 TCTTCCTTGTTTGATGCTCCTGG - Intergenic
1061242560 9:129383054-129383076 TGTGGGTTGTTTTCTGCCCCTGG - Intergenic
1186800778 X:13090446-13090468 CCTTCGTTCTTTTCTGCTTCTGG + Intergenic
1187550628 X:20301227-20301249 TCTACGTGATTCTGTGCTCCTGG - Intergenic
1189606199 X:42680788-42680810 TCTTCAGTGCTTTCTGCTCCTGG + Intergenic
1189666844 X:43364848-43364870 TCTACCTTGCTCTATGCTCCTGG - Intergenic
1190259380 X:48788377-48788399 TCTATCTCCTTTTCTGCTCCCGG - Intronic
1190589354 X:51983158-51983180 GGTATTTTGTTTTCTGCTCCGGG + Intergenic
1193639332 X:83992691-83992713 TTTAGGTTGTTTTCTTTTCCTGG - Intergenic
1194105708 X:89763983-89764005 CCTATGGAGTTTTCTGCTCCGGG + Intergenic
1195152102 X:102082470-102082492 TCCAGCTTGTCTTCTGCTCCTGG + Intergenic
1198030927 X:132752737-132752759 TCTACCCAGCTTTCTGCTCCAGG + Intronic
1199009380 X:142740713-142740735 TCAGCGTTGTATTCTGCACCTGG - Intergenic
1200457670 Y:3411812-3411834 CCTATGGAGTTTTCTGCTCCAGG + Intergenic
1201382771 Y:13402007-13402029 TCCAAGTTTTTTACTGCTCCTGG - Intronic