ID: 1154388690

View in Genome Browser
Species Human (GRCh38)
Location 18:13918218-13918240
Sequence GATGGGTATGTTCAGTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154388690_1154388695 6 Left 1154388690 18:13918218-13918240 CCAATCTACTGAACATACCCATC No data
Right 1154388695 18:13918247-13918269 CAGTTGCCTTTCTGTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154388690 Original CRISPR GATGGGTATGTTCAGTAGAT TGG (reversed) Intergenic
No off target data available for this crispr