ID: 1154391615

View in Genome Browser
Species Human (GRCh38)
Location 18:13941429-13941451
Sequence AAGCCCCCAGCTTCTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154391609_1154391615 23 Left 1154391609 18:13941383-13941405 CCTAACATTGTGCATTGAGCTTG No data
Right 1154391615 18:13941429-13941451 AAGCCCCCAGCTTCTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154391615 Original CRISPR AAGCCCCCAGCTTCTCATCC AGG Intergenic