ID: 1154391748

View in Genome Browser
Species Human (GRCh38)
Location 18:13942608-13942630
Sequence ACCTCAGAGAAACTTTGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154391746_1154391748 -3 Left 1154391746 18:13942588-13942610 CCATACTCTTCAAGTAAACTACC No data
Right 1154391748 18:13942608-13942630 ACCTCAGAGAAACTTTGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154391748 Original CRISPR ACCTCAGAGAAACTTTGTTA GGG Intergenic
No off target data available for this crispr