ID: 1154396606

View in Genome Browser
Species Human (GRCh38)
Location 18:13996588-13996610
Sequence CTATGTCATCTCTGCAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154396606_1154396607 2 Left 1154396606 18:13996588-13996610 CCAAAGTTGCAGAGATGACATAG No data
Right 1154396607 18:13996613-13996635 AACTTACATGTTTTTACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154396606 Original CRISPR CTATGTCATCTCTGCAACTT TGG (reversed) Intergenic
No off target data available for this crispr