ID: 1154399890

View in Genome Browser
Species Human (GRCh38)
Location 18:14026224-14026246
Sequence CCAGGAGGGGACCCGCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154399890_1154399896 0 Left 1154399890 18:14026224-14026246 CCAGACTGCGGGTCCCCTCCTGG No data
Right 1154399896 18:14026247-14026269 TTTCTCATGCTTCTCATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154399890 Original CRISPR CCAGGAGGGGACCCGCAGTC TGG (reversed) Intergenic
No off target data available for this crispr