ID: 1154406055

View in Genome Browser
Species Human (GRCh38)
Location 18:14092235-14092257
Sequence CAGGACCAGGATAAGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154406043_1154406055 21 Left 1154406043 18:14092191-14092213 CCCTGAGACTTGCTGATGTCTAT 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1154406055 18:14092235-14092257 CAGGACCAGGATAAGGGGTCAGG 0: 1
1: 0
2: 1
3: 20
4: 214
1154406044_1154406055 20 Left 1154406044 18:14092192-14092214 CCTGAGACTTGCTGATGTCTATG 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1154406055 18:14092235-14092257 CAGGACCAGGATAAGGGGTCAGG 0: 1
1: 0
2: 1
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154406055 Original CRISPR CAGGACCAGGATAAGGGGTC AGG Intronic
900399636 1:2467653-2467675 CAAGACCAAGGTAAGGGGGCAGG + Intronic
902407306 1:16191788-16191810 CAGGACCTGGAGATGGCGTCTGG - Intergenic
902837373 1:19055456-19055478 CAGGACCAGGAGATGGGGCTGGG + Intergenic
903231818 1:21926973-21926995 CAGGACCAGGAGGTGGGGGCCGG + Intronic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
905207452 1:36350988-36351010 CAGGACCAGACTAGGGGGTCTGG - Intronic
905367678 1:37463179-37463201 CAGGACCAGGACCAGGGGAAAGG + Intergenic
905776349 1:40669740-40669762 CAGGACCAAGCTAAGGAGTTTGG + Intergenic
906060410 1:42944773-42944795 CAGAGGCAGGCTAAGGGGTCAGG - Intronic
906699600 1:47848345-47848367 TATGACCAGGATCAGGGCTCTGG + Intronic
908787481 1:67749545-67749567 CAGTACCAGGAGGAAGGGTCTGG + Intronic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
912360471 1:109090839-109090861 CTGGACCTGGGTAGGGGGTCCGG - Exonic
915360414 1:155283022-155283044 CAGGAACAGAATGAGGGTTCGGG + Intronic
915699886 1:157781933-157781955 CAGGAGCATGGTAAGAGGTCAGG + Intergenic
915896585 1:159815783-159815805 CCTGACCAGGACAAGGGCTCAGG - Intronic
917168719 1:172144821-172144843 TAGGACCAGGAAAAGGGGGAGGG + Intronic
918189893 1:182163964-182163986 CAGCAGCAGGACAAGAGGTCAGG + Intergenic
919179610 1:194063265-194063287 CAGGAACAAGATAAGGTGTGTGG - Intergenic
921622755 1:217344180-217344202 CAGGACCATGCGAAGGGGTCTGG + Intergenic
923031100 1:230249575-230249597 CAGGCCCAGGAAAAGGGGCTTGG + Intronic
1065962437 10:30744821-30744843 CATGTCCAGCATAAGGGGACTGG - Intergenic
1067028817 10:42866716-42866738 CAGCACCCGGATACGGGGGCTGG - Intergenic
1067102494 10:43343100-43343122 CGGGCCCAGGACAAGGGGTGGGG - Intergenic
1070112126 10:73496099-73496121 CAGGACGAGGCCAAGGGATCAGG + Intergenic
1072727163 10:97821839-97821861 CAGGAGCAGGAAAGGGGGGCAGG + Intergenic
1074236810 10:111592950-111592972 AAAGATCAGGATAAGGGGACTGG + Intergenic
1074424978 10:113342751-113342773 CAGGGCCAGGAACAGGGCTCAGG - Intergenic
1074487822 10:113905302-113905324 CAGGATCAGAATAAGGGATGAGG - Intronic
1074582923 10:114737508-114737530 CAGGATCAGGACTTGGGGTCTGG - Intergenic
1074844634 10:117386749-117386771 CAGGACCAGGATTAGGGTGAGGG - Intergenic
1075002927 10:118811062-118811084 CGGGACCAGGAGAATGGGGCAGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075908313 10:126102129-126102151 GAGGGCCAGGATGAGCGGTCAGG + Intronic
1076001687 10:126917814-126917836 CAGGGCCAGTTTAAGAGGTCAGG + Intronic
1076350441 10:129811546-129811568 CAGCACCGGGAGAAGGGGGCAGG - Intergenic
1082072105 11:47947478-47947500 CAGGCCCAGGATAATGCGTGTGG - Intergenic
1082828833 11:57600351-57600373 CAGGACCTGGGTAAGGAGGCTGG - Exonic
1083379648 11:62254891-62254913 CAGAACCAGGATATGAAGTCAGG - Intergenic
1083541725 11:63516086-63516108 AAAGAACAGGATAAGGGGCCCGG - Intronic
1084171754 11:67404345-67404367 CAGAGCCAGGGTAAGGGGGCAGG + Exonic
1084718605 11:70889780-70889802 CAGGACCAGGACCAGGAGTGGGG + Intronic
1085870809 11:80347204-80347226 CAGGCACAGGATACGGGGTGGGG + Intergenic
1088229467 11:107659262-107659284 CAGGGCAAGTATAAGGGGCCAGG - Intronic
1089666137 11:120021203-120021225 CAGGAGCAGGAGGAGGGGTTGGG - Intergenic
1090961828 11:131563972-131563994 CAGGACCAGGACAAGGTCTGGGG - Intronic
1091451959 12:578018-578040 CAGGCCCAGGGTATGGGGCCGGG - Intronic
1091863295 12:3806205-3806227 CAGGACCAGGCGCAGGGGTTTGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1093516292 12:19990575-19990597 CAGGGCCAGGATTAGGGTGCAGG + Intergenic
1096178446 12:49538301-49538323 GAGGGGCAGGACAAGGGGTCTGG + Intergenic
1100282415 12:93130542-93130564 CAGGAAGAGGGAAAGGGGTCAGG - Intergenic
1101256655 12:102984456-102984478 CAGGAGCAGGAGAAATGGTCTGG + Intergenic
1103242713 12:119428457-119428479 CAGAACCAGGGTCAGGGCTCAGG + Intronic
1103736920 12:123066424-123066446 CAGGAGCAAGAGCAGGGGTCTGG + Intronic
1105015142 12:132782071-132782093 GAGGAACAGGCTCAGGGGTCTGG - Intronic
1111070024 13:83153615-83153637 CAGGACCAGTATGAGAGTTCTGG + Intergenic
1113176689 13:107572960-107572982 AAGTACCAGGAGATGGGGTCTGG - Intronic
1113892583 13:113744142-113744164 CAGGGCCAGGATTAGGGTTAAGG + Intergenic
1114580078 14:23749189-23749211 CAGGACCTGGCGAGGGGGTCGGG + Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1117524180 14:56580338-56580360 CAGGACCAGGATAAAAGATCTGG - Intronic
1121467941 14:94128049-94128071 CAGGACCTGGAGGAGGGATCCGG - Intronic
1121888620 14:97568035-97568057 CAGGAACAGGACAAGGAGTAAGG - Intergenic
1122371720 14:101232846-101232868 CAGGCCCAGGAGCTGGGGTCTGG + Intergenic
1122979726 14:105186012-105186034 GAGGATCAGGATGGGGGGTCAGG + Intergenic
1123097429 14:105773146-105773168 CAGGAGCAGGGTCAGGGGACAGG - Intergenic
1123476570 15:20595611-20595633 CAGAACCAGGATCAAGGCTCAGG - Intergenic
1123641441 15:22404753-22404775 CAGAACCAGGATCAAGGCTCAGG + Intergenic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1129429942 15:75492515-75492537 CAGGACAATGAGAATGGGTCAGG - Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1130134852 15:81173997-81174019 CAGGAACAGGCTAAGGTTTCAGG + Intronic
1130313122 15:82771858-82771880 CAAGGCCAGGCGAAGGGGTCTGG - Intronic
1132372333 15:101307567-101307589 CAAGCCCAGGATCAGGGGCCAGG + Intronic
1133077221 16:3289217-3289239 AAGCATCAGGATAAAGGGTCGGG - Intronic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1134450009 16:14357628-14357650 CAGGAGCAGGGTAAGGGGCCTGG + Intergenic
1136723812 16:32342019-32342041 CAGGGTCAGGACAAGGGGTAGGG + Intergenic
1136746067 16:32592871-32592893 GAGGAGCAAGATAAGGGATCTGG - Intergenic
1136842141 16:33548063-33548085 CAGGGTCAGGACAAGGGGTAGGG + Intergenic
1138106063 16:54287603-54287625 CGGGACCGGGAGAAGGGGTAGGG - Intergenic
1138528952 16:57624729-57624751 CAGGACAGGGATAAGGGGTTAGG - Intronic
1141578474 16:84981162-84981184 CAGGAGCAGAAAAAGGAGTCAGG + Intronic
1141685103 16:85565697-85565719 CAGGGTCAGGTGAAGGGGTCAGG - Intergenic
1141955053 16:87365187-87365209 CTGGGCCAGGCCAAGGGGTCAGG + Intronic
1203002619 16_KI270728v1_random:175746-175768 CAGGGTCAGGACAAGGGGTAGGG - Intergenic
1203048195 16_KI270728v1_random:852076-852098 GAGGAGCAAGATAAGGGATCTGG - Intergenic
1203134225 16_KI270728v1_random:1712152-1712174 CAGGGTCAGGACAAGGGGTAGGG - Intergenic
1203152306 16_KI270728v1_random:1848360-1848382 CAGGGTCAGGACAAGGGGTAGGG + Intergenic
1142467169 17:142662-142684 TAGGATCAGGATTAGGGGTTAGG - Intergenic
1143329298 17:6121769-6121791 CAGGACCAGACCTAGGGGTCAGG - Exonic
1146753465 17:35404130-35404152 CAGGCCCAGGATGTGGGGCCAGG + Intergenic
1147793859 17:43029009-43029031 CAGAACCAGGATATGGGGACTGG - Exonic
1148789631 17:50166103-50166125 GAGGCCCAGGATGAGGGGGCAGG + Intronic
1149521957 17:57324258-57324280 CAGGACCAGGGTGTGGGCTCCGG - Intronic
1152514949 17:80817628-80817650 CAGGTCCGGGAGAAGGGGTGGGG + Intronic
1152749565 17:82056430-82056452 CAGGACCAGGACAGGAGGCCAGG - Intronic
1152938056 17:83152156-83152178 CAGGACCAGGACAGAGGCTCCGG - Intergenic
1153583426 18:6598127-6598149 AAGGACCATGATCAGGGCTCTGG + Intergenic
1153656523 18:7287649-7287671 CAGGATCAGGCTTAAGGGTCTGG - Intergenic
1154406055 18:14092235-14092257 CAGGACCAGGATAAGGGGTCAGG + Intronic
1155397356 18:25400696-25400718 CAGAACCAGGATCTGGTGTCAGG + Intergenic
1156527292 18:37778751-37778773 CAGGACTAGGAAAAGGCGTCGGG + Intergenic
1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG + Intergenic
1157106647 18:44780300-44780322 CAGGATCAGGAAGAGGAGTCAGG - Intronic
1157362878 18:47034933-47034955 CAGGACCAGGAAAAGGCCTGGGG - Exonic
1158763208 18:60415354-60415376 CCGGCCCAGGATAAGGGTTCTGG - Intergenic
1160917592 19:1504540-1504562 CTGGACCAGGAGGAGGGGTGGGG + Intergenic
1160969213 19:1759991-1760013 CTGGGCCAGGATCAGGGATCAGG + Intronic
1161468923 19:4446823-4446845 CAGGATCAGGGTAAGTGGACAGG - Exonic
1161951207 19:7469141-7469163 CAGGCCCAGGCGAAGGGGTGGGG - Intronic
1162028692 19:7908297-7908319 CAGGAGCAGGGGAAGGGCTCTGG - Intronic
1162597652 19:11641502-11641524 CAGGACCAGGATAAGATGGAGGG - Intergenic
1163587735 19:18173210-18173232 CGGGACCACGGTGAGGGGTCTGG + Intronic
1165079280 19:33298434-33298456 CAGGACCAGGAGGAGGACTCGGG + Intergenic
1165734887 19:38169861-38169883 GGGGCCCAGGCTAAGGGGTCAGG + Intronic
1166395053 19:42433530-42433552 CAGGAAAAGGATAAGGGGCAGGG + Intronic
1167605644 19:50480257-50480279 CAGGACCAGGGTAGGGGATGAGG - Intronic
1168152917 19:54458618-54458640 AAGGACCAGGACAAGGGTTGGGG - Intronic
925100489 2:1240275-1240297 CAGGACAACGTTAAGGGCTCTGG - Intronic
929535843 2:42783704-42783726 CAGGGCCAGGATGAGTGGACAGG + Intronic
929885661 2:45875461-45875483 AGGGACCAGGAACAGGGGTCTGG + Intronic
930465264 2:51740023-51740045 CTTGGCCAGGATGAGGGGTCAGG + Intergenic
932011495 2:67982176-67982198 CATGGCCAGGATAAGAAGTCTGG + Intergenic
932904935 2:75739116-75739138 CAGGACCAGGATGCAGGCTCTGG - Intergenic
933849354 2:86353082-86353104 CTGGACCAGGATGAGGGCTAAGG - Intergenic
934980757 2:98837807-98837829 CAGGATCAGGATAGGGGCCCTGG - Intronic
936538881 2:113334080-113334102 TAGGAGAAGGACAAGGGGTCAGG + Intergenic
937451735 2:122007852-122007874 CAGCACCGGCATAAGAGGTCAGG - Intergenic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
942244899 2:173998938-173998960 CAGGTCCAGGAAAATGGGTATGG + Intergenic
942423905 2:175838854-175838876 CAGGACCACTATAAGTGATCTGG + Intergenic
942926685 2:181441506-181441528 CAAGAGCAGAATAAGGGGTGGGG - Intergenic
942930807 2:181490174-181490196 CAGGCCCAGGATGTGGGGCCAGG + Intronic
943004935 2:182377302-182377324 CAGGAGAAAGATAAAGGGTCAGG - Intronic
943450866 2:188040271-188040293 CAGGCCCAGGATGTGGCGTCGGG - Intergenic
945245401 2:207712259-207712281 CAGGGCAAGAATAAGGGGTGGGG - Intronic
946595336 2:221299932-221299954 CAGGAGCCTGCTAAGGGGTCTGG + Intergenic
947401096 2:229732310-229732332 CAAGCACAGGATAAGGGGTGGGG - Intergenic
948024914 2:234769161-234769183 CAGAACCAGGCTCAGGGGCCAGG - Intergenic
948354710 2:237368819-237368841 CAGGACCAGGACCAGGTGTTGGG + Exonic
1168754203 20:304860-304882 CAAGACCAAGCTAAGGGGCCAGG + Intergenic
1170600309 20:17836577-17836599 GCGGTCCAGGATGAGGGGTCTGG - Intergenic
1172242685 20:33423692-33423714 CAGGCCCAGTATAAGTGGACTGG + Intronic
1172519281 20:35556791-35556813 CAAGACTAGGAGAGGGGGTCTGG + Intronic
1172606540 20:36217879-36217901 CTGGACCAGAATCAGAGGTCAGG + Intronic
1173160149 20:40646494-40646516 CAGGGCCAGGCTAGGGGGTGGGG + Intergenic
1179930485 21:44568203-44568225 CAGGAGCAGGAGGAGGGGTGGGG - Intronic
1180609062 22:17084314-17084336 CAGAACCAGGCAAAGGGGTGGGG + Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181043015 22:20201754-20201776 CAGCACCAGGAGCAGGGGTGAGG + Intergenic
1181085094 22:20436286-20436308 CGGGACCAGGAATGGGGGTCCGG - Intronic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1182776947 22:32838309-32838331 CAGGACCTGGAGATGGGGCCTGG + Intronic
1183917575 22:41134734-41134756 CAGGACTAGGAAAAGGGATGAGG + Intronic
1185346839 22:50314096-50314118 CTGGAAGAGGATCAGGGGTCTGG + Intronic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
953670673 3:44959340-44959362 CAGGACCAGGGTAGGGGGGTGGG + Exonic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
954475142 3:50737316-50737338 CAGGACCAAGACAGGGGGTGGGG + Intronic
955342781 3:58138265-58138287 CAGGACCTGGAGAAGAGTTCAGG - Exonic
956145024 3:66183516-66183538 CAGCATCAGGGTAAGGGGTAGGG - Intronic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
960839406 3:121941026-121941048 CAGGGCCAGGAATTGGGGTCAGG - Exonic
962010108 3:131383647-131383669 CATGACCAGGGGAAGGTGTCAGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
973217354 4:47684489-47684511 CAGAACCAGGATAGGAGTTCTGG - Intronic
973882791 4:55290817-55290839 CAGGCCCAGAATAAGTGGTCGGG - Intergenic
974907741 4:68078152-68078174 CTGGACCAGGATCAGGGGAGGGG - Intronic
977106586 4:92893431-92893453 CAGAGCCAGGACAAGGGCTCAGG - Intronic
982430008 4:155312159-155312181 CAGGGTCAGGATAAGTGGTTTGG + Intergenic
983830333 4:172318761-172318783 GAGGACAAGGATAAGGGAACTGG + Intronic
986327378 5:6686260-6686282 CGGGACCACTGTAAGGGGTCTGG + Intergenic
986432232 5:7692682-7692704 GAGGACAAGGCCAAGGGGTCAGG - Intronic
988170830 5:27653106-27653128 CAGGGGCAGGATAATGTGTCAGG + Intergenic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
989153484 5:38322279-38322301 GAGGACCAGGAAAAGGGCTCGGG + Intronic
995761342 5:115565441-115565463 CAGGGCCAGGATCAGGGCCCTGG + Intergenic
996467425 5:123819964-123819986 CAGGACCAGGATCAAGGTTATGG - Intergenic
996653772 5:125914675-125914697 CAGGATGTGGAAAAGGGGTCAGG + Intergenic
997618599 5:135270462-135270484 GAGGACCTGGAGCAGGGGTCTGG + Intronic
1001378696 5:171287603-171287625 CTGGACCTGGATAGGGGGTGGGG - Intronic
1001985468 5:176071263-176071285 GAGGAGCAAGATAAGGGATCTGG - Intronic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1002231403 5:177766862-177766884 GAGGAGCAAGATAAGGGATCTGG + Intronic
1002263936 5:178016882-178016904 GAGGAGCAAGATAAGGGATCTGG - Intronic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1005029254 6:21493813-21493835 CAGGCACAGGATAGGGGGTATGG - Intergenic
1006273244 6:32980705-32980727 CAGACTCAGGCTAAGGGGTCAGG + Exonic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006810947 6:36820165-36820187 CTGGGTCAGGATGAGGGGTCCGG - Intronic
1010155292 6:72785351-72785373 CAAGAACAGGAGCAGGGGTCAGG + Intronic
1011700348 6:89949712-89949734 CAGGACCGGGATAAACGGTGAGG + Intronic
1016854468 6:148652696-148652718 CAGGGCCAGGAAACGGGCTCTGG - Intergenic
1017593814 6:156007096-156007118 CAGGACCAGGAAAATGGGTTGGG - Intergenic
1017983405 6:159422159-159422181 CAGGACCAGGCTCAGCAGTCTGG + Intergenic
1019204728 6:170350456-170350478 GAGGAACAGGATCAGGGATCTGG - Intronic
1020270300 7:6590619-6590641 CAGGACCCGGAGAAGGGTTTGGG - Intronic
1020986447 7:15141118-15141140 CAGGACTAGGATCAGGTGACTGG - Intergenic
1021834230 7:24652119-24652141 CAGGTCCAAGATAAGGCCTCAGG - Intronic
1029371676 7:100154711-100154733 CAGAACCAGGGTAAAGGGCCGGG + Exonic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034413857 7:150955036-150955058 CAGGACCAGGAGAAGCCGGCAGG - Intronic
1034538897 7:151743698-151743720 CAGGAGCAGCATGATGGGTCAGG + Intronic
1036752641 8:11453031-11453053 CAGGCTCAGGCTGAGGGGTCAGG - Intronic
1037766906 8:21777759-21777781 AGGGACCTGGATAAGGAGTCGGG + Intronic
1037929362 8:22868613-22868635 TAGGAGCAGGTTTAGGGGTCAGG - Intronic
1042343434 8:67704024-67704046 CTGGAGGAGGATAAGGGGCCTGG - Intronic
1043881293 8:85546324-85546346 AATGACCAGGATAAGGGGTGGGG + Intergenic
1049315313 8:141963135-141963157 CAGGGCCAGGAAATGGGGTGGGG + Intergenic
1049371367 8:142269305-142269327 CAGGAGCAGGATCAGGGCTCAGG + Intronic
1049413324 8:142483584-142483606 TGTGACCAGGATAAGGGCTCAGG - Intronic
1049714383 8:144082965-144082987 CAGGCCCAGGCTTAGGGCTCGGG + Intronic
1053123988 9:35564800-35564822 CAGGGCCAGGCTGAGGGCTCAGG + Intergenic
1053263860 9:36696078-36696100 CAGGGACAGGAGAAGGGGTGAGG - Intergenic
1056114601 9:83429760-83429782 CAGGACCAGGATAAAGAATAAGG - Intronic
1056271583 9:84953054-84953076 CAGCACCAGGAGAAGGGGCTGGG - Intronic
1057408121 9:94792075-94792097 CAGGACCAGGATTAGAGCTGGGG - Intronic
1057739776 9:97701201-97701223 GAGGACCAGGATAAGGGGGTGGG - Intergenic
1057857445 9:98612250-98612272 CAGAACTAGGATATGGGGGCTGG + Intronic
1057905345 9:98978323-98978345 CAGGGCCAGGTTAAGCGTTCAGG - Intronic
1059051728 9:110933969-110933991 CAAGCCCAGGATGTGGGGTCTGG + Intronic
1060140031 9:121201688-121201710 CAGGACCAGGAACAGGAGTGCGG + Exonic
1061261765 9:129484065-129484087 CAGGAGCAAGATCAGGGTTCGGG + Intergenic
1061268192 9:129520680-129520702 CAGGACCATGGTCAGGGGTCAGG - Intergenic
1061471992 9:130834682-130834704 CCAGACCAGGATATGAGGTCAGG - Intronic
1062170761 9:135133457-135133479 CAGGACCAGGACAGGGGGCTTGG + Intergenic
1062424166 9:136498338-136498360 CAGGGCCAGGATGAGGGCTGGGG + Intronic
1203786659 EBV:132130-132152 CGGAACCAGGAGAAGGGGTCTGG + Intergenic
1189331159 X:40145821-40145843 GCGGACCCGGATTAGGGGTCTGG + Intronic
1190036344 X:47028509-47028531 AAGTGCCAGGATAAGGAGTCTGG - Intronic
1190380977 X:49839599-49839621 CAGGACCTGGAGAAGGGATGTGG - Intergenic
1191934448 X:66411351-66411373 CAGGACCAGTAAAAGGAGTTGGG - Intergenic