ID: 1154406176

View in Genome Browser
Species Human (GRCh38)
Location 18:14093295-14093317
Sequence GTTTTAAAGGAGAAAGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154406176_1154406181 24 Left 1154406176 18:14093295-14093317 CCTGCCGCTTTCTCCTTTAAAAC 0: 1
1: 0
2: 1
3: 39
4: 246
Right 1154406181 18:14093342-14093364 AAGTTGAGTTTAGTTCATGAGGG 0: 1
1: 1
2: 6
3: 31
4: 313
1154406176_1154406180 23 Left 1154406176 18:14093295-14093317 CCTGCCGCTTTCTCCTTTAAAAC 0: 1
1: 0
2: 1
3: 39
4: 246
Right 1154406180 18:14093341-14093363 AAAGTTGAGTTTAGTTCATGAGG 0: 1
1: 0
2: 0
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154406176 Original CRISPR GTTTTAAAGGAGAAAGCGGC AGG (reversed) Intronic
900303637 1:1991177-1991199 GTTTAAAAGGTCAAAGAGGCCGG + Intronic
900718924 1:4162526-4162548 GTTTTGAAGGAGACAGTGCCAGG + Intergenic
902208007 1:14883914-14883936 GTTTTACAGAAGAGAGAGGCAGG + Intronic
902421284 1:16282520-16282542 TTTTTAAAAGAGAAAATGGCCGG - Intronic
904712694 1:32442698-32442720 GTTTAAAAGTAGAAGGTGGCTGG + Intergenic
904797470 1:33068024-33068046 GTTTTAAAGGAGAAAGTGAGTGG - Intronic
904904073 1:33881354-33881376 GTTCTGTAGGAGAAAGGGGCAGG + Intronic
906233070 1:44182160-44182182 TTTTAAAAGAAGAAAGCAGCCGG - Intergenic
906577690 1:46905520-46905542 GTCTTAAAGGAGAAAGGGAGAGG - Intergenic
907385168 1:54121365-54121387 GTTTTAAAGGAGAAAAGTCCTGG - Intergenic
907589457 1:55652286-55652308 TTTTTAAAGGAGGAAGGGGTAGG + Intergenic
907700457 1:56781827-56781849 ATTTTAAAGGAGAAAGGGGTTGG - Intronic
908514337 1:64876512-64876534 CTTATTAAGGAGAAAGCTGCCGG - Intronic
909167721 1:72249725-72249747 TTTTGAAAGGAGAAAGAGGGAGG + Intronic
909206409 1:72763373-72763395 GTTGTAAAGAAGAAAGAGGCAGG + Intergenic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
910326768 1:86017977-86017999 GGGTTAAAGGAGAAAGTGACAGG + Intronic
911554476 1:99326776-99326798 GTTTTAAAGGAAAGAGAGGAAGG - Intergenic
915492691 1:156260026-156260048 GATTTAAGGGTGAAAGCTGCTGG + Intronic
915843421 1:159236907-159236929 TTTTTAAAGGGTAAAGGGGCTGG + Intergenic
916009169 1:160689076-160689098 GTTTTAAAGGAGAAAGGGAGAGG + Intronic
916104548 1:161421602-161421624 GGTTTAAATGAGAACTCGGCAGG - Intergenic
916278896 1:163026457-163026479 CTTTTCAAGGAGAAAGCCCCTGG + Intergenic
916691430 1:167193701-167193723 GTTTTAAAGGACACAGTGCCTGG + Intergenic
917768016 1:178244535-178244557 ATTTTAAAGAAGAAATAGGCTGG - Intronic
918086811 1:181252520-181252542 GTCTTAAAGGAGAAAGGGAGAGG - Intergenic
919183207 1:194112015-194112037 GGTTCAAAGGAGCAAGCGGGCGG - Intergenic
920922950 1:210313215-210313237 GTTTTAAAACAGAATGGGGCTGG - Intergenic
921135460 1:212255628-212255650 GTTTTATATGGGAAAGGGGCCGG - Intergenic
923038087 1:230299626-230299648 GTTTAAAAGGATGACGCGGCTGG - Intergenic
924392312 1:243576297-243576319 GTTTTCAAGGAGAATGCTTCTGG - Intronic
1063506952 10:6608190-6608212 GTTTTAAAGCAGAAAGCAGCAGG - Intergenic
1063643804 10:7858376-7858398 GTTCTAAAGGATCAAGCGCCAGG - Intronic
1069162526 10:65108952-65108974 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1070560826 10:77565264-77565286 GTTTTAGAGGACAACGCGGATGG + Intronic
1072704489 10:97670840-97670862 GTTTTAAAGAAGATAGGGCCAGG + Intronic
1073308794 10:102524615-102524637 GTTTTAAAGAAGAAATAGGCTGG - Intronic
1073354205 10:102840886-102840908 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1074744816 10:116521911-116521933 GTATTAAAGGAGAAAACACCTGG + Intergenic
1075243100 10:120795807-120795829 GTTATAAAGGAGAAAACTGAAGG + Intergenic
1078326049 11:10381637-10381659 ATTTTAAAGAATAAAGAGGCTGG - Intronic
1078839532 11:15065491-15065513 GTTTTAAAGGAGAAAGGGAGAGG + Intronic
1078923366 11:15851860-15851882 TTTTTAAAGGACACAGCGGAGGG - Intergenic
1080149654 11:29036028-29036050 GATTTAAAGGAGGAAGGGGCAGG + Intergenic
1080581381 11:33646789-33646811 TTTTTAAAGGAAAAAGAGGGAGG - Intronic
1081286001 11:41270970-41270992 GATTTATAGGAGAAAGGGGAGGG - Intronic
1082296388 11:50445464-50445486 GTTTTAAAGGAGATAGGGAGAGG - Intergenic
1082299618 11:50490348-50490370 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1082309734 11:50632030-50632052 GTTTTAAAGGAGAAAGAGAGAGG + Intergenic
1082572834 11:54763656-54763678 GTATTAAAGGAGAAAGGGAGAGG - Intergenic
1083035712 11:59635565-59635587 GTTTTAAATGATAAAGAGACAGG - Intergenic
1084181931 11:67451203-67451225 GTTTTTAAGGACAAAGCTGTCGG + Intergenic
1084223988 11:67703617-67703639 GTCTTAAAGGAGAAAGGGAGGGG - Intergenic
1085109441 11:73874689-73874711 GTTTAAAAAGTGAAAGAGGCTGG + Intronic
1087680487 11:101213999-101214021 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1090972962 11:131658671-131658693 CTTTAAAAGGTGTAAGCGGCCGG + Intronic
1091014965 11:132042080-132042102 GTTTTAAATGAGTAAGCAGTAGG + Intronic
1093033932 12:14315301-14315323 CTTTGAGAGGAGAAAGCGGGTGG + Intergenic
1093209981 12:16296900-16296922 ATTTTAAATGAGAAAGGGGAAGG - Intergenic
1093365511 12:18291910-18291932 GTTTTAAAGAATATAGGGGCTGG + Intronic
1094022806 12:25931947-25931969 GTTTTAAAATAAAAAGAGGCTGG - Intergenic
1094641538 12:32280600-32280622 GTTTTTAAGTAGAAAGGGGGAGG + Intronic
1094865744 12:34528412-34528434 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
1095523528 12:43096974-43096996 GTTTTAAAGGCAAAAGCAGAGGG - Intergenic
1097211664 12:57375601-57375623 TTTTCAAAGGAGAAACAGGCTGG + Intronic
1099555335 12:84102791-84102813 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1101535809 12:105615323-105615345 ATTTTAAAGAAAAATGCGGCTGG + Intergenic
1101773630 12:107774679-107774701 ATTTTCAAGGAGAAAGCCTCTGG + Exonic
1101856535 12:108448174-108448196 TTTTTAAAGGAGAAAGAGCAAGG - Intergenic
1103862656 12:124026780-124026802 TTTTTAAAGGAGGAAGCATCAGG + Intronic
1105814107 13:24017738-24017760 GATTTAAAGGAGAAAGAAGGAGG - Intronic
1107200162 13:37705717-37705739 GTTTTAAATGAGAAAGATGCAGG - Intronic
1107246695 13:38305323-38305345 AGTTTAAAGAAGAAAGAGGCTGG - Intergenic
1107688175 13:42925080-42925102 GCTTAGAAGGTGAAAGCGGCAGG - Intronic
1113023786 13:105918502-105918524 ATTTTAAAGGAGAGATCAGCAGG + Intergenic
1113152636 13:107281936-107281958 GTTTTAAAGGAGAGACCAGGTGG - Intronic
1115550396 14:34499749-34499771 ATTTTAAAGGAAGAAGAGGCTGG + Intergenic
1117324642 14:54658010-54658032 GTTTTAAAAGAGAATGTGGCCGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118762128 14:68886348-68886370 GTTTTAAAGAAGAAAGAGTAGGG - Intronic
1119572146 14:75684182-75684204 GTTTTAAAGGAGATAGTTTCTGG + Intronic
1120568092 14:86083899-86083921 GGTTTAAAGGAGAAAGGGAGAGG + Intergenic
1122128803 14:99593379-99593401 GTTTTGAAGGGGACAGAGGCAGG - Intronic
1123458981 15:20451139-20451161 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1123659081 15:22549279-22549301 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124312945 15:28643771-28643793 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124584117 15:30989879-30989901 GTTTTAAACCTGAAATCGGCCGG - Intronic
1125301379 15:38257012-38257034 GTTTTAAGTGAGAAAGCAGAGGG - Intronic
1125466288 15:39956298-39956320 GTTATAAAGGGGAATGAGGCTGG - Intronic
1125567671 15:40689495-40689517 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1127207068 15:56732698-56732720 GCTTTTAAGGAGAAATCTGCTGG - Intronic
1131648122 15:94367824-94367846 GTTTTAAAAGAGAAGGTGGGAGG - Intronic
1131862556 15:96669803-96669825 CTTTTCAAGGAGAAACGGGCTGG + Intergenic
1134000945 16:10782351-10782373 ATTTCAAAGGAGCAAGGGGCAGG - Intronic
1136703408 16:32164418-32164440 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1136764291 16:32763181-32763203 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1136803807 16:33107205-33107227 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1137071380 16:35907649-35907671 GTTTTTAAGGATAATGCGGAAGG + Intergenic
1138767764 16:59624466-59624488 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1203066648 16_KI270728v1_random:1025305-1025327 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1142669501 17:1481306-1481328 GTTTTAAAGGTTAAGGCAGCAGG - Intronic
1143044289 17:4064319-4064341 GCTTAAAAAGAGAAAGCGACAGG + Intronic
1143263709 17:5619827-5619849 ATTTTAATGAAGAAAGGGGCAGG - Intergenic
1143807347 17:9440355-9440377 ATTATAAAGGAGGAATCGGCAGG - Intronic
1144048042 17:11470911-11470933 GGTCTAAAGAAGAAAGAGGCCGG + Intronic
1144405142 17:14945238-14945260 GTTTTAAAACATAAAGCTGCTGG - Intergenic
1145801487 17:27688763-27688785 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1147400173 17:40176232-40176254 GCTTGAAAGGGGAAAGTGGCTGG - Intergenic
1147592116 17:41690334-41690356 GTTTTATAGGAAAAAGCAGAAGG + Intronic
1147843243 17:43387571-43387593 GTTTTAAAAGAAAAATCTGCCGG + Intergenic
1149556191 17:57575124-57575146 GTTAAAAAAGAGAATGCGGCCGG - Intronic
1150538524 17:66072188-66072210 GTTTTTAGGGATAAAGAGGCAGG - Intronic
1151509931 17:74552066-74552088 GTTGTAGAGGAGACAGTGGCAGG + Intergenic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1153021891 18:636921-636943 TTTAAAAAGGAGAAAGGGGCTGG - Intronic
1154406176 18:14093295-14093317 GTTTTAAAGGAGAAAGCGGCAGG - Intronic
1155975061 18:32119718-32119740 TTTTTAAATGAGAAAGAGGCTGG - Intronic
1157118225 18:44882519-44882541 GGTGTGAAGGAGAAAGAGGCAGG - Intronic
1157645903 18:49270902-49270924 GTTCTATAGGAGAAGGGGGCAGG - Intronic
1157655140 18:49378345-49378367 GTTTTAAATAAGAAAGCTGGTGG - Intronic
1157756550 18:50222905-50222927 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1159478343 18:68954120-68954142 GTGTTAAAGAAGAAAGTGACTGG + Intronic
1159481643 18:68996940-68996962 GTTTCAAAGGAGAAACCAGATGG + Intronic
1161353474 19:3806263-3806285 GTCTCAAAAAAGAAAGCGGCGGG - Intronic
1163432225 19:17275199-17275221 GTTTTAAAACAGAATGGGGCCGG - Intronic
1163941862 19:20502491-20502513 GTCTTAAAGGAGAAAGAGAGAGG + Intergenic
1164288953 19:23849928-23849950 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1164330241 19:24247499-24247521 GTTTTAAAGGATAAAGGGAGAGG - Intergenic
1164377955 19:27705975-27705997 GTTTTAAAGGAGAAAGAGAGAGG + Intergenic
1165510596 19:36264579-36264601 GATTGAAAGGAGAAAGAGGTTGG + Intergenic
1167670636 19:50851309-50851331 ATTTCAAAGGAGGAAGAGGCTGG + Intergenic
1167792426 19:51690290-51690312 GTTTTGAAGGAGTTAGGGGCTGG - Intergenic
1168027918 19:53656940-53656962 TTTTAAAAAGAAAAAGCGGCTGG - Intergenic
926856064 2:17257188-17257210 TTTTTAAAGGAGAGAGGGGAAGG + Intergenic
928739805 2:34338149-34338171 GATTTATAGGAGAAAGGGTCTGG - Intergenic
929641631 2:43585966-43585988 ATATTAATGGAGAAAGGGGCTGG + Intronic
930632552 2:53769544-53769566 CTTTAAAAGGAGAAAGGGGCTGG + Intronic
931600124 2:63994670-63994692 GTCTTAAAGGAGAAAGGGAGAGG - Intronic
932355680 2:71066573-71066595 GATTTAAAGAAGAAAGTAGCCGG - Intronic
933820087 2:86103268-86103290 GTTTTACAGGAGGAAGAAGCAGG + Intronic
935142338 2:100364401-100364423 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
936911565 2:117598974-117598996 GTTTTGAAGGGGAAAGAGTCAGG - Intergenic
937112355 2:119376492-119376514 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
939318504 2:140583470-140583492 ATATTAAAGGAGAAACTGGCTGG - Intronic
940102503 2:150057577-150057599 GTTTTTAGGGAGAAAGAGGGTGG + Intergenic
940951549 2:159681037-159681059 GAAGTAAAGGAGAAAGCGGGGGG + Intergenic
941346602 2:164376784-164376806 CTTTGAAAGAAGAAAGCGTCTGG + Intergenic
941436099 2:165475146-165475168 GTTTTAAAGCAGAAAGATTCTGG + Intronic
944605237 2:201346576-201346598 GTTTGATAGGAAAAAGCGGTGGG - Exonic
944774491 2:202948926-202948948 GTTTTCAAGGAGAATGCTTCTGG + Intronic
945723395 2:213446937-213446959 GTCTTAAAGGAGAAAGGGAGAGG - Intronic
945960985 2:216134730-216134752 GTTTAAAAGAAGGAAGGGGCTGG - Intronic
946040363 2:216777913-216777935 GGTGTAAATGAGAAAGTGGCTGG + Intergenic
948143292 2:235690292-235690314 CCTTTAAAGGTGAAAGCAGCAGG + Intronic
1170844110 20:19947798-19947820 GATTTGAAGGAGTGAGCGGCAGG - Intronic
1170975988 20:21165276-21165298 GCTTTGAAGGAGAAAGAGGAGGG + Intronic
1171426947 20:25054940-25054962 GTTGTAAAGGTGAAAGTGGAAGG - Intronic
1174406252 20:50305218-50305240 GTTTTAGAGGAAAAAGAGACTGG - Intergenic
1175234616 20:57501480-57501502 TTTTTAATGGAGGAAGGGGCTGG - Intronic
1176980366 21:15375048-15375070 GTTTTAAAAGAGAAAGAGAGAGG - Intergenic
1179641407 21:42749839-42749861 GTTTAAAAGTACAAAGGGGCTGG + Intronic
1180663796 22:17493266-17493288 TATTTAAAGGAAAAAGAGGCCGG - Intronic
1180991465 22:19939790-19939812 GTCTTAAAGGAGAAAGGGAGAGG - Intronic
1184700419 22:46168054-46168076 CTCTTAAAGAAGAAAGCGACCGG + Intronic
950260936 3:11543133-11543155 GATTAAAAGGAGAAAACGACAGG - Intronic
950772696 3:15324684-15324706 GTTTTAATGGAGAAAGTGCTGGG + Intronic
951429139 3:22585906-22585928 TTTCTAAAGGAGAAAGCACCTGG - Intergenic
952287101 3:31980296-31980318 GTTTAAAAACAGAAAGAGGCCGG - Intronic
953592573 3:44273644-44273666 GTTTTAAAGGATGAAGAGGATGG - Intronic
954783469 3:53076655-53076677 GTTCTAAAGGTGAAAGAGGCAGG + Intronic
956673530 3:71713912-71713934 ATTTTAAAGGAGATATGGGCTGG + Intronic
959841523 3:110982298-110982320 GTTTGCAAGGAGATAGAGGCAGG - Intergenic
959888384 3:111527771-111527793 GTCTTAAAGGAGAAAGGGAGAGG - Intronic
961922839 3:130446011-130446033 GTTTTAAAGGAGAAATGGAGAGG + Intronic
962744066 3:138384414-138384436 GTTTTGAAGGAGGAAACGACAGG + Intronic
964102445 3:153003693-153003715 TTTGTAAAGGACAAAGCAGCAGG + Intergenic
965987211 3:174769505-174769527 TTTTAAAGGGAGAAAGCGTCTGG + Intronic
967029182 3:185589963-185589985 GTTTTAAAAGAGAATGCTGGTGG - Intronic
968143184 3:196275437-196275459 TTTTGAAAGGAGAAACAGGCTGG + Intronic
969008896 4:4044640-4044662 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
972520977 4:39856517-39856539 ATTTAAAAGGAAAATGCGGCTGG + Intronic
972613170 4:40673837-40673859 CTGCTAAAGCAGAAAGCGGCAGG - Intergenic
974034617 4:56807027-56807049 GTTTAAAAGAAGAAACAGGCTGG + Intergenic
974095908 4:57363709-57363731 ATTTTAAAGGAGATAGGGGTGGG - Intergenic
974605335 4:64143914-64143936 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
975401995 4:73949409-73949431 ATTTTAAAGGAGAAAGGGAGAGG + Intergenic
975873545 4:78808560-78808582 GTATTAAAAAAGGAAGCGGCCGG - Intronic
975955050 4:79826909-79826931 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
978124118 4:105115171-105115193 CTTTAAAAGGATAAACCGGCTGG - Intergenic
978577306 4:110199707-110199729 TTTTTAAAGGAGGAAGGGACCGG + Intergenic
979033930 4:115687279-115687301 GTTTTTAAGGAGAATGCTTCTGG + Intergenic
979307328 4:119162265-119162287 GTGTGAAAGGAGAAAGCAGGCGG + Intronic
979538391 4:121850741-121850763 GTTTTAAAGGAGGGAGTGGAAGG + Intronic
979788376 4:124746225-124746247 GGTTTAGAGGAGAAAGAGGTGGG - Intergenic
980222069 4:129930320-129930342 GTTTTTAAGGATAATTCGGCGGG - Intergenic
980978750 4:139635904-139635926 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
981308555 4:143272210-143272232 GCTTTGAAGGAGATAGCGGATGG - Intergenic
983224424 4:165072674-165072696 GTTTTAAAGGAAAAGCCAGCAGG + Intergenic
985738566 5:1600535-1600557 GTTTTAGAGGTGAAAGGGACTGG + Intergenic
987120442 5:14762059-14762081 TTTTTAAAGGCAAAAGGGGCTGG - Intronic
987224105 5:15821778-15821800 CTCTCAAAGGAGAAAGCAGCAGG + Intronic
988059235 5:26145740-26145762 GTTTTAAATGAGGAAGCTGAGGG + Intergenic
989318673 5:40110233-40110255 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
991404414 5:66288021-66288043 GTTTTAAATGAGACAGGGTCTGG - Intergenic
996010475 5:118477004-118477026 TTTTTAGAGGGGAAAGTGGCTGG + Intergenic
997691670 5:135831582-135831604 GTCTTAAAGAAGAAGGGGGCAGG + Intergenic
998634456 5:143937521-143937543 TTTTTAAAAAAGAAAGTGGCAGG + Intergenic
998649635 5:144103656-144103678 TTTGTAAATGAGACAGCGGCTGG + Intergenic
998714018 5:144860827-144860849 TTTTTAAAACAGAAAGCAGCAGG - Intergenic
1000073485 5:157763255-157763277 ATTTTAAAGGTGAAATTGGCTGG - Intergenic
1000611785 5:163383038-163383060 GTCTTAAAGGATAAACAGGCTGG + Intergenic
1001521865 5:172400134-172400156 GTTTCAAAGGAGAAAGGGAGAGG - Intronic
1003335390 6:5166989-5167011 GTTTTATAGGTGAGAGCTGCCGG + Intronic
1004355828 6:14929194-14929216 GATTTAAAGATGAAAGTGGCAGG - Intergenic
1004982161 6:21037310-21037332 GCATTACAGGAGAAAGGGGCAGG + Intronic
1005239035 6:23802966-23802988 GGTTTAAAGCAAAAAGTGGCAGG - Intergenic
1006937639 6:37729422-37729444 GTCTAAACGGAGAGAGCGGCAGG + Intergenic
1007617602 6:43189828-43189850 TTTTAAAATGAGAATGCGGCTGG - Intronic
1008077692 6:47162917-47162939 GTTCTAAAGGAGATACAGGCAGG - Intergenic
1008102368 6:47405688-47405710 GTTAGAAAGTAGAAAGGGGCAGG + Intergenic
1010492151 6:76489354-76489376 GTTTTAAAGGAAAAAGGGAGAGG + Intergenic
1011646307 6:89461933-89461955 GTTTTAAAAGTGAAATGGGCCGG + Intronic
1011903481 6:92331149-92331171 GTTTAAAATGATAAAACGGCCGG - Intergenic
1015411209 6:132895754-132895776 GATTAAAAGGAGAAACAGGCTGG + Intergenic
1016248146 6:142012054-142012076 GTTATAGATGAGAAAGCAGCAGG + Intergenic
1017850300 6:158299484-158299506 GTCTTAAAGGAGAAAGGGAGAGG + Intronic
1020419701 7:7987830-7987852 CTTTTAAAGGCCAAAGCGGAAGG - Intronic
1021459217 7:20866467-20866489 GTTTGAAAGGAGAAAGGCCCAGG - Intergenic
1021802649 7:24323183-24323205 GTTTTAAAGGAAAATGAGCCTGG + Intergenic
1022575744 7:31495323-31495345 GTTTAAAAGGGGAAAGCAGCTGG + Intergenic
1024553273 7:50581487-50581509 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
1026743577 7:72994170-72994192 TTTTAAAAAGAAAAAGCGGCTGG - Intergenic
1026803490 7:73414836-73414858 TTTTAAAAAGAAAAAGCGGCCGG - Intergenic
1027100159 7:75370907-75370929 TTTTAAAAAGAAAAAGCGGCTGG + Intergenic
1029099116 7:98113554-98113576 ATTTTAAATGAGAAAGGGCCAGG - Intronic
1030797192 7:113803389-113803411 GTTTTAAAGGAGAGTGGGGGAGG + Intergenic
1033289433 7:140070501-140070523 GGTTTAAAGGAGAAGGCAGTGGG + Intergenic
1033430983 7:141289417-141289439 CTTGAAAAGGAGAATGCGGCTGG + Intronic
1035910406 8:3559349-3559371 GGTTTAAAGGAGTAAGCTGATGG + Intronic
1036250167 8:7155305-7155327 GTTGTAAAGGAGAAAGGGAGAGG + Intergenic
1036367321 8:8132145-8132167 GTTGTAAAGGAGAAAGGGAGAGG - Intergenic
1036883561 8:12533517-12533539 GTTGTAAAGGAGAAAGGGAGAGG + Intergenic
1037915370 8:22769653-22769675 GTGATAAAGGAGAAAGAGGCTGG - Intronic
1038934763 8:32236728-32236750 GCTTGAGAGGAGAAAGAGGCAGG + Intronic
1040139804 8:43896841-43896863 GTCTTAAAGGAGAAAGGGAGAGG - Intergenic
1040353005 8:46587380-46587402 GTCTTAAAGGAGAAAGGGAGAGG - Intergenic
1042247680 8:66724274-66724296 TTTTAAAAGGAGAAATAGGCTGG - Intronic
1042426801 8:68658561-68658583 ATTTTCAAAGAGAAAGTGGCAGG - Intronic
1043274850 8:78380233-78380255 GTCATAAAAGAGAAAGAGGCGGG + Intergenic
1044142526 8:88672912-88672934 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1045004913 8:97909227-97909249 GATTTAAAGTTGAAAGAGGCTGG - Intronic
1048941885 8:139406919-139406941 GTTTTCAAGGAGAAAGTAGCTGG + Intergenic
1050518733 9:6474407-6474429 GATTAAAAGGAGAAATGGGCTGG + Intronic
1050562222 9:6845708-6845730 GCATGAAAGGAGAAAGGGGCCGG + Intronic
1051198637 9:14592335-14592357 ATTTTAAAAGAGAAAGAGGAAGG - Intergenic
1051796446 9:20876855-20876877 AATTAAAAGGAGAAAGGGGCAGG - Intronic
1053562237 9:39208568-39208590 GTTTGAAAGGTGATAGCGGCTGG + Intronic
1053828042 9:42046567-42046589 GTTTGAAAGGTGATAGCAGCTGG + Intronic
1054134881 9:61410390-61410412 GTTTGAAAGGTGATAGCGGCTGG - Intergenic
1054602515 9:67140879-67140901 GTTTGAAAGGTGATAGCAGCTGG - Intergenic
1056027394 9:82513247-82513269 GTGATAAAGGAGACAGCAGCAGG + Intergenic
1056716891 9:89038793-89038815 TTTTTAAAAGAGAAAGCTGACGG + Intronic
1058653055 9:107195093-107195115 GTTTTAGAAGAGAAAGCAACTGG + Intergenic
1059198660 9:112394648-112394670 GTCTTAAAGGAGAAAGGGAGAGG + Intronic
1059385328 9:113959903-113959925 CGTTTAAAGGAGAAGGGGGCCGG - Intronic
1059872832 9:118596958-118596980 GTTTAAAAGGAGAGAGCAGAGGG - Intergenic
1062178101 9:135175577-135175599 GTTTCACAGGTGAAAGGGGCTGG + Intergenic
1185974910 X:4709673-4709695 GTTTTAAAGGATAATTTGGCAGG - Intergenic
1186794625 X:13032649-13032671 GTCTTAAAAGAGTAAGCAGCAGG + Intergenic
1187520788 X:20012094-20012116 GTTTTTCAGGAGAAAGGGGAAGG - Intronic
1188432599 X:30121786-30121808 GTTTAAAATGAGAAAGAGGCAGG + Intergenic
1188823339 X:34800918-34800940 GTTTTAAAGGTGAAAGAGAGAGG - Intergenic
1189557837 X:42163858-42163880 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1189763282 X:44343900-44343922 GGGTTAAACCAGAAAGCGGCGGG - Intergenic
1190163260 X:48049528-48049550 GCTTTAAGGGAGAAAGATGCTGG + Intronic
1190733115 X:53237453-53237475 GGTGTTAAGGAGAAAGAGGCAGG - Intronic
1190846892 X:54201563-54201585 GTATCAAAGAAGAAAGCGTCTGG - Intronic
1191125292 X:56947681-56947703 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
1191828216 X:65389003-65389025 GTCTCAGAGGAGTAAGCGGCTGG + Intronic
1194079966 X:89449319-89449341 GTTTTAAAGGGGAAAGGGCTTGG + Intergenic
1197665325 X:129216985-129217007 GTTGTAACAGAGAAAGAGGCAGG + Intergenic
1199041598 X:143120733-143120755 GTTTTAAAGGAGAGACCAGGTGG - Intergenic
1200432588 Y:3104593-3104615 GTTTTAAAGGGGAAAGGGCTTGG + Intergenic
1202246985 Y:22830089-22830111 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1202399974 Y:24463837-24463859 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1202470807 Y:25206249-25206271 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic