ID: 1154406901

View in Genome Browser
Species Human (GRCh38)
Location 18:14100667-14100689
Sequence GAGTGGGTATGGTGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1035
Summary {0: 1, 1: 1, 2: 4, 3: 107, 4: 922}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154406901 Original CRISPR GAGTGGGTATGGTGGGGAGA AGG Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900737154 1:4306135-4306157 CAGTGGGGATGCTAGGGAGAAGG + Intergenic
901059240 1:6464491-6464513 GAGTGGGTCAGGCAGGGAGAAGG + Intronic
901061835 1:6475270-6475292 GGGTGGGGAGGGTGGGGAGGAGG - Intronic
901145432 1:7061680-7061702 GGGTGGGTTTGGTGGGGTGGTGG + Intronic
901408911 1:9069365-9069387 GAGGGATTATGGTGGGGAGAGGG - Intronic
901436557 1:9250444-9250466 GTGTGTGTAGGGTGGGGAGTGGG - Intronic
901801071 1:11708239-11708261 GAGTTGATATGGTGAGGAGGAGG + Intronic
901874335 1:12158372-12158394 GAGTGGGTTTGGAGGGGTTACGG + Intergenic
902352175 1:15864864-15864886 AAGGGGGTAGGGTGGGGAGGTGG + Intronic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903360776 1:22775734-22775756 GTGTGGGTACGGTAGGGATAGGG + Intronic
904032710 1:27543189-27543211 GAGGGAGTAGGGAGGGGAGAGGG + Intronic
904092792 1:27956920-27956942 CAGTGGGTATCTTGGGGAGGTGG + Intronic
904517165 1:31065513-31065535 GAGTGGTTGTGGGGGTGAGAAGG - Intronic
904541002 1:31233288-31233310 GGGTGGGTAGAATGGGGAGAGGG + Intronic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
904756319 1:32770674-32770696 GAGTGGGTCCGGCGGGGAGGGGG - Exonic
904823466 1:33259405-33259427 GTGTGGGTAAGGTGGGGACCGGG + Intronic
904894102 1:33801181-33801203 GAGTGAGGATGGGAGGGAGAGGG - Intronic
905876558 1:41435454-41435476 GAGCAGGAATGGTGGGGAGCAGG + Intergenic
906187400 1:43871913-43871935 GAGGGGGTATGTGGGGGAGGGGG + Intronic
906456403 1:46000984-46001006 TAGCGGGTATAATGGGGAGAGGG + Intronic
906746527 1:48225936-48225958 GAGTGGGGAAGGTGGTGAGAAGG - Intronic
907082767 1:51639517-51639539 GAGTTGGGGTGGTGGGGACAAGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907311697 1:53542512-53542534 GTGTGGGGCGGGTGGGGAGATGG + Intronic
907358467 1:53895562-53895584 GAGTGGGCAAGTCGGGGAGAAGG - Intronic
907460171 1:54601193-54601215 GAGTGTGTGTGTTGGGGAGGAGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908829293 1:68163555-68163577 GAGGGGGAGTGGTGGGGAGCTGG - Intronic
910103762 1:83607735-83607757 GAGAGGGTAAGATGGGGAAAGGG + Intergenic
911103633 1:94113216-94113238 GAGGGTGTATGGTGGGGAGGGGG - Intronic
911742615 1:101403672-101403694 GAGGGTGTATGGTGGGAGGAGGG - Intergenic
911767917 1:101701651-101701673 GAGTGGGGAGGGGGGGGAGGGGG - Intergenic
912370880 1:109173121-109173143 GACTGGGTATTCTGGGGAGGGGG + Intronic
912373864 1:109194406-109194428 GAGTGGATCTGAGGGGGAGAGGG - Exonic
912449228 1:109759173-109759195 GTGTGTGTGTGGTGGGGTGATGG + Intronic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
914419857 1:147519416-147519438 GAGTGGGACTTATGGGGAGAAGG + Intergenic
914425292 1:147570578-147570600 GAGTGGGAATGGGGGGCAAAGGG - Intronic
914829446 1:151159988-151160010 GAGAGGGTCTGGAGGGGAGGGGG + Exonic
915360360 1:155282835-155282857 GAGGAGGTGGGGTGGGGAGATGG + Exonic
915747965 1:158179733-158179755 GAGGGGGTGAGGTGAGGAGAAGG + Intergenic
915834939 1:159169291-159169313 GAGTGGGGATGGGTGGGATAGGG - Intergenic
916058696 1:161084827-161084849 GTGTGGGTTTGGGGGGGTGAGGG + Intronic
916068327 1:161154271-161154293 AAGGAGGGATGGTGGGGAGAGGG + Intronic
916075442 1:161197722-161197744 GAAGGGGTGGGGTGGGGAGAGGG + Intronic
916090768 1:161306279-161306301 GATGGGGGATAGTGGGGAGAGGG + Intronic
916116922 1:161492897-161492919 GAGTGTGTGTGGTGGGGGGATGG + Intergenic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
917007829 1:170435052-170435074 GAGTAGGTTTGGTAGGGAAAGGG + Intergenic
917623178 1:176818901-176818923 AATTGGGAGTGGTGGGGAGATGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917728995 1:177855350-177855372 GAGTGAGTGAGGTGGGGGGATGG + Intergenic
918105718 1:181413579-181413601 GAGTGAGTATGGCGGGGACGCGG + Intronic
919502102 1:198349973-198349995 GAGTGGGGATGGAGGTGGGATGG + Intergenic
920406839 1:205721115-205721137 GAGGGGGCAGGGTGGGGGGATGG + Intronic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
920536048 1:206737245-206737267 GAGTGGGTAGAGTGGGTAGCAGG + Intergenic
920545948 1:206818539-206818561 GAGTGGGGATGTGGGTGAGAGGG + Intronic
920572839 1:207030959-207030981 GAGATGGTGGGGTGGGGAGAGGG + Intronic
920744819 1:208616761-208616783 GGGTGGGCGTGGTGGGGAGGTGG + Intergenic
920823861 1:209406053-209406075 GAGTGTGCTTGCTGGGGAGAGGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921431097 1:215067029-215067051 GAGTGGTTATTTTGTGGAGAGGG + Intronic
921925401 1:220706656-220706678 GAGTGGGGAGGCTGGGGTGAAGG - Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922020560 1:221700110-221700132 GAGAGGGAATGGAAGGGAGAGGG + Intergenic
922082163 1:222308047-222308069 GGGTGGGGATGGTGAGGAGGAGG - Intergenic
922770836 1:228182323-228182345 GGGTGTGTATGGTGGGGACGGGG + Intergenic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
922811331 1:228416946-228416968 GAGTGTGGAGGGTGGGGAGTTGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923649858 1:235864342-235864364 GAGTAGGTTTGGTGGGGAGAAGG - Intronic
924740950 1:246794025-246794047 GGGAGGGCAGGGTGGGGAGAAGG + Intergenic
924799271 1:247315638-247315660 GAGTGGGTAAGGAAGAGAGAGGG + Intronic
1063009061 10:2004505-2004527 GAGTGGGCATGACGGGGAGCTGG + Intergenic
1063039240 10:2319980-2320002 GTGTGTGTGTGGTGGGGGGAGGG - Intergenic
1063122657 10:3115482-3115504 GACTGGGGATGCTGGGGTGAAGG + Intronic
1063487162 10:6430686-6430708 GAGTGGGGCTGGTGGGGAGTTGG + Intronic
1065173317 10:23053238-23053260 GAGTGGGGAGGGTGTGTAGAAGG + Intergenic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1067057025 10:43058362-43058384 GAGTGGTTTGGGTGGGGAGTGGG - Intergenic
1067199525 10:44155333-44155355 GGGTGGGTGGGGTGGGGAAATGG + Intergenic
1067448563 10:46367711-46367733 CAGTGGGTATCGTGGGCAGCAGG - Intergenic
1067588811 10:47493054-47493076 CAGTGGGTATCGTGGGCAGCAGG + Intergenic
1067635936 10:48001145-48001167 CAGTGGGTATCGTGGGCAGCAGG + Intergenic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1068230199 10:54161590-54161612 GACAGGGTATGGTGGGGTGGGGG - Intronic
1068636742 10:59356548-59356570 GAGTGGGAATGGTTGGGAACAGG - Intronic
1068896528 10:62209604-62209626 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1069516688 10:69083203-69083225 GTGTGGCTATGGTGATGAGAAGG + Intergenic
1069680636 10:70282976-70282998 GGGTGGGGTTGTTGGGGAGATGG - Intronic
1070132500 10:73665152-73665174 CAGTGGGTATCGTGGGCAGCAGG + Intergenic
1070594545 10:77823158-77823180 GAGTGGGGATGGTGGTGATGGGG + Intronic
1070642409 10:78179307-78179329 GAGGCGCTATGCTGGGGAGAAGG + Intergenic
1071609183 10:87018924-87018946 CAGTGGGTATCGTGGGCAGCAGG - Intergenic
1071702540 10:87955596-87955618 GAGAAGGAGTGGTGGGGAGAAGG + Intronic
1072029989 10:91509775-91509797 GAGCGGGTAGGGTGGGAGGAGGG + Intronic
1072438112 10:95431813-95431835 GATGGGTTAAGGTGGGGAGATGG + Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1072862958 10:99025699-99025721 GAGTGGGGAGGGTAGGAAGAGGG + Intronic
1072874809 10:99160974-99160996 GAGTGGCCAGGGTGGGAAGATGG + Intronic
1072967904 10:99990311-99990333 GAGAGGCTAAGGTGGGCAGATGG + Intronic
1073206251 10:101770926-101770948 GAGAGGGGCAGGTGGGGAGACGG - Intronic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1074155001 10:110790304-110790326 GAGCTGGAATGGTGGGGAGGCGG - Intronic
1074243079 10:111658398-111658420 AAATGGGTTTGGTGGTGAGAAGG - Intergenic
1074658210 10:115619147-115619169 GAGTGGATTTGCTGGGGACAGGG + Intronic
1075761862 10:124863512-124863534 GGGTGGGTATGCTTGGGAGTAGG + Intergenic
1076108866 10:127845997-127846019 GTTTGGGTATGTTGGGGACATGG - Intergenic
1076980572 11:202454-202476 GAACGGTGATGGTGGGGAGAAGG - Intronic
1077037683 11:503170-503192 GGGTGGGTGGGGTGGGGAGAGGG + Exonic
1077248154 11:1549011-1549033 GAGTGAGAATGCTGGGGAGAGGG - Intergenic
1077287740 11:1775306-1775328 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287881 11:1775740-1775762 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077573270 11:3356907-3356929 GAGCGGGTATGAGGTGGAGATGG + Intronic
1077868618 11:6243013-6243035 GTGTGGGGAGGGTGGAGAGAGGG - Intronic
1079307775 11:19338899-19338921 GAATGGCTGTGGTGGGGAGGAGG - Intergenic
1079688729 11:23396375-23396397 GGTTGGGGATGGTGGGGAGGGGG + Intergenic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1080117342 11:28635836-28635858 GACTGTGTATGTTGGGGATAGGG + Intergenic
1081370410 11:42293692-42293714 AAGTGGGGATGGTGAGGGGAGGG + Intergenic
1081548217 11:44087662-44087684 CAGTGTATGTGGTGGGGAGAGGG + Intergenic
1081787284 11:45756525-45756547 GAGTGGGCCTGGCTGGGAGAGGG + Intergenic
1082755503 11:57072086-57072108 GAGTGGTTAGGGAGGGGTGATGG - Intergenic
1082895106 11:58181656-58181678 GAAAGGGAAAGGTGGGGAGAGGG + Intergenic
1083199968 11:61114984-61115006 GGGTGGGTGAGCTGGGGAGAAGG + Intronic
1083253321 11:61482116-61482138 GAGTGGGTGGGCTGGGGACAAGG - Intronic
1083253546 11:61482963-61482985 TGGTGGGGATGGTGGGGACAAGG - Intronic
1083535525 11:63463657-63463679 GAATGGGTATGGTGGGGTGGAGG - Intronic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1083894130 11:65611696-65611718 CAGTGGGGAGGGTGGGGAGCAGG + Intronic
1084021874 11:66422601-66422623 GACAGTGGATGGTGGGGAGAAGG - Intronic
1084086478 11:66857385-66857407 GGGAGGGTATGGCGGGGAGTGGG + Intronic
1084090786 11:66878352-66878374 GAGTGAGTGTGGTGTGGACAGGG - Intronic
1084473463 11:69376147-69376169 TAGTGGGTGGGGTGGGGAGTTGG - Intergenic
1084774149 11:71364499-71364521 GAGTGGGTAGGGTGGATGGATGG + Intergenic
1084889080 11:72227956-72227978 GTGTAGGTCTGGTGGGGAGACGG + Intronic
1084933218 11:72573458-72573480 GAGGGGGTGGGGTGGGGTGAGGG - Intergenic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085824797 11:79833684-79833706 GACTGGGTATGGTGAGGATGGGG - Intergenic
1085845560 11:80060685-80060707 GAGTGGGTAACGTGGGGAGGGGG + Intergenic
1085958407 11:81429343-81429365 GAGTGGGAGTGGTGGGGGGAAGG + Intergenic
1086975701 11:93130297-93130319 GGCTGGGAATGGTAGGGAGAAGG - Intergenic
1087318138 11:96628780-96628802 GACTGGGTGGGGTGGGGTGAGGG + Intergenic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1087900270 11:103632551-103632573 GAATGGGGAGGGTGAGGAGAGGG + Intergenic
1088087430 11:105997785-105997807 GATTGGGACTGGTGGGGAGAGGG + Intronic
1088127673 11:106448401-106448423 GAAAGGGTGAGGTGGGGAGAAGG + Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088527642 11:110773976-110773998 GAGTGGGGATGGTGGATAAATGG + Intergenic
1088796750 11:113271926-113271948 GTGGGGGTAGGGTGGGGAGGTGG - Intronic
1089308002 11:117538776-117538798 GGGGGAGTGTGGTGGGGAGAAGG + Intronic
1089374655 11:117986054-117986076 GAGTGCGGAAGGTGGGGTGAGGG - Intergenic
1089402870 11:118174672-118174694 GAGTGTTTGGGGTGGGGAGATGG - Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089581306 11:119483419-119483441 GAGGGGGGAAGGTGGGGAGAAGG - Intergenic
1089905270 11:122031724-122031746 GAGTGGGGAGGGTGGGTGGAGGG + Intergenic
1090263273 11:125338099-125338121 GAGAGCGGATGCTGGGGAGATGG - Intronic
1090378517 11:126308718-126308740 GGGTGGGGAGGGTGGGTAGAGGG - Intronic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1090777624 11:129979349-129979371 TGGTGGGTATCCTGGGGAGAGGG - Intronic
1090966617 11:131603238-131603260 AAGTGGGTATGTTGGAGGGATGG - Intronic
1091300504 11:134504160-134504182 GTGTGGGTGGGGTGGGGAAAGGG + Intergenic
1092254909 12:6921553-6921575 GAGAGAGCATGGTGGGGAGGGGG - Intronic
1092273885 12:7044682-7044704 GGGTGGGGTGGGTGGGGAGAGGG - Intronic
1092278668 12:7082183-7082205 GAGTGTGCTTGATGGGGAGAGGG + Intronic
1092282600 12:7109013-7109035 GGGGGGGTAGGGTGGGGGGAGGG + Intronic
1092288595 12:7144751-7144773 GGGTGGGTTTAGAGGGGAGAGGG + Intronic
1092461367 12:8689735-8689757 GAGAGGGTATGGTGGTGATGCGG + Intronic
1092968482 12:13668986-13669008 GAGAGGGAATGGAGGGGAGGTGG + Intronic
1093894448 12:24561729-24561751 GAGGGGGAGTGGTAGGGAGAAGG + Intergenic
1094063179 12:26336208-26336230 GAGTGGGGAGGCTGGGGAGTTGG - Intergenic
1094495273 12:30985426-30985448 GAGTGAGAATGATGGGGAGCAGG - Intronic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095519011 12:43039380-43039402 GAGAGGCTATGTTGGGGAGAAGG + Intergenic
1095529029 12:43162661-43162683 GAGTGGGTGGGGTGGGGAAAGGG + Intergenic
1095904065 12:47359322-47359344 GAGTGGGGAGGATGGGAAGAGGG - Intergenic
1095925518 12:47575526-47575548 GACTGGGAATGGTGGGGGGTGGG - Intergenic
1095956155 12:47807558-47807580 GAATGGGAATGCTGGGGAGGAGG - Intronic
1096074684 12:48795678-48795700 GGGTGGGTAGGGTGGGGTAATGG - Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096765466 12:53885121-53885143 GGGTGGGAGTGGTGAGGAGAGGG + Intergenic
1096806800 12:54145852-54145874 CAGTTGGTTTGGTGTGGAGAAGG - Intergenic
1096880771 12:54667919-54667941 GAATGGGTATGGTATGTAGATGG + Intergenic
1097246357 12:57609834-57609856 GTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1097294687 12:57949864-57949886 GACTGGGTTGAGTGGGGAGATGG - Intronic
1097971756 12:65640488-65640510 GGGTGGTGATGGTGGTGAGAGGG - Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1099395977 12:82139357-82139379 GAGTGTGTGTAGTGGGGAGGAGG - Intergenic
1100231761 12:92616186-92616208 GAGAGAGTAAGGTGGGGAAAAGG - Intergenic
1100931904 12:99619226-99619248 GCCTGGGCATGGTGTGGAGAGGG - Intronic
1101093635 12:101313710-101313732 GGGTGTGTGTGGTGGGGAGTGGG + Intronic
1101504999 12:105337867-105337889 GATGGGGTATGGTGGGGGGTGGG + Intronic
1101905407 12:108821138-108821160 GAGAGGCTGAGGTGGGGAGATGG + Intronic
1102008056 12:109601338-109601360 AATTAGGTATGGTGGGGAGAGGG - Intergenic
1102011819 12:109623824-109623846 GGGTAGGTCTGGTGGGGAGCTGG - Intergenic
1102575549 12:113853975-113853997 TGGTGGGCATGGTAGGGAGAAGG + Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102744972 12:115242467-115242489 GAGCCGGTAAGGAGGGGAGAAGG - Intergenic
1103051209 12:117781439-117781461 GAGTGCAGATGATGGGGAGAGGG + Intronic
1103254263 12:119527263-119527285 GAGGGGGGATGGTGGGAGGAGGG + Intronic
1103316523 12:120060344-120060366 GGGTGTGTAGGGTGGGGTGAGGG + Intronic
1103659202 12:122500403-122500425 GAGTGGGTCTGGTCAGGAGACGG + Exonic
1103949041 12:124541610-124541632 GAGTGGAGATGGTGGGGGGGTGG + Intronic
1104016992 12:124968166-124968188 GAGCAGGTATGATGGGGACAAGG + Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104575713 12:129964185-129964207 CAGTGGAAAAGGTGGGGAGAAGG + Intergenic
1105256959 13:18750119-18750141 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1105259640 13:18769494-18769516 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1105262316 13:18788811-18788833 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1106048660 13:26169299-26169321 GAGAGTGTATGGGAGGGAGAAGG + Intronic
1106186563 13:27414973-27414995 GTGTGTATATTGTGGGGAGACGG + Intergenic
1106388924 13:29316488-29316510 GAGTCGGGGTGTTGGGGAGAGGG - Intronic
1107728545 13:43324782-43324804 GCGTGGGTGTGGTGGGGAGCAGG - Intronic
1108495346 13:51019267-51019289 GAGTGGGTAGGGTGGGGTTCAGG - Intergenic
1108601348 13:51997875-51997897 GAGCGGGGAGGGTGGGAAGAAGG + Intronic
1109094270 13:58091682-58091704 GAGTGTGCATGGTGGTGAGTGGG - Intergenic
1109095426 13:58107861-58107883 GCCTGGGTATGGTGTGGAGAGGG + Intergenic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1109673081 13:65636401-65636423 GTGGGGGTAGGGTGGGGAGGGGG - Intergenic
1109691367 13:65895028-65895050 GAGGGGTTAGGGAGGGGAGAGGG + Intergenic
1110065833 13:71104410-71104432 GGGTGGGAGTGGTGGGGGGAGGG - Intergenic
1110999080 13:82154788-82154810 GCCTGGGCATGCTGGGGAGATGG + Intergenic
1111166223 13:84461201-84461223 GAGTGTTTGTGGTGGGGAGGGGG + Intergenic
1111987228 13:95077682-95077704 GAGGGGGTAGGGTGGGGGTAAGG + Intronic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112151454 13:96769113-96769135 GTGTGTGTTTGGTGGGGAGGTGG - Intronic
1112359925 13:98708151-98708173 GGTGGGGAATGGTGGGGAGAGGG + Intronic
1112478523 13:99753340-99753362 GACTGGCTGTGGTGTGGAGAAGG + Intronic
1112772200 13:102803647-102803669 GAGTGAGTTTGGTGGCGAGACGG - Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113775497 13:112942863-112942885 ATGTGGGGATGGTGCGGAGAAGG - Intronic
1113993274 14:16045555-16045577 GGGTGGGTGGGGTGGGGTGAGGG + Intergenic
1114421785 14:22589770-22589792 GAGTGGGTGTGGTGAGGGGCGGG + Intergenic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114533957 14:23411675-23411697 GAGTGGGTATGTTGGTGGGTTGG + Intergenic
1114811164 14:25901305-25901327 GTGTGTGTATAGGGGGGAGATGG - Intergenic
1114926831 14:27412581-27412603 AAGTGGTGAAGGTGGGGAGAAGG + Intergenic
1115724174 14:36194708-36194730 GAGGGGGAAGGGAGGGGAGAGGG + Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116782403 14:49250813-49250835 GAGGGGCTATGGTGAGGGGAGGG - Intergenic
1116993647 14:51301209-51301231 GAATGGATATGGAGGGGTGAAGG - Intergenic
1117457441 14:55912279-55912301 CAGAGGGCATGGTGGGGAGGGGG + Intergenic
1118181041 14:63493494-63493516 GCGTGTGTGTGGTGGGGGGAGGG + Intronic
1118775622 14:68972157-68972179 GACTGGGTGGGTTGGGGAGAGGG - Intronic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1120224757 14:81778218-81778240 AAGGGGGTATGGTGGTGAAAGGG - Intergenic
1120704995 14:87736547-87736569 CAGGGGGTGTGGTGGGGGGAAGG - Intergenic
1120900998 14:89575390-89575412 GGGTGGGGATGATAGGGAGAAGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121564936 14:94902136-94902158 GTGTGTGTATGGTGGGGTGGGGG - Intergenic
1122189060 14:100025479-100025501 GAGTGCCCATTGTGGGGAGAGGG - Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122655737 14:103258331-103258353 GGGCGGGCAGGGTGGGGAGAGGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1122973918 14:105163397-105163419 GAGGGGGTGTGCTGGGGAGTGGG - Intronic
1202847952 14_GL000009v2_random:199399-199421 GAGAGGGGAACGTGGGGAGAGGG - Intergenic
1124207316 15:27732561-27732583 GAGTGTGGAGGGTGGAGAGAGGG + Intergenic
1125128643 15:36255040-36255062 GAGTGGGGAAGGTGGGGGGCGGG - Intergenic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1125573503 15:40739129-40739151 GAGGGGGGATGTGGGGGAGAAGG - Intronic
1126056588 15:44735569-44735591 GACTGGGTTTGGTGGGGGGGGGG + Intronic
1126301906 15:47206805-47206827 GCCTGTGGATGGTGGGGAGAGGG - Intronic
1126640827 15:50824950-50824972 GAGTGGGTATCTCGGGTAGAGGG + Intergenic
1127414832 15:58748734-58748756 GAAAGGGTTTGGTCGGGAGAAGG - Intronic
1127536120 15:59891415-59891437 GAGTGGGTATCCTGGTGAGGGGG + Intergenic
1127817653 15:62625836-62625858 GAGTGGGCAGAGTGGGCAGATGG + Intronic
1127883229 15:63176266-63176288 TAGTGGATCTGTTGGGGAGAAGG - Intergenic
1128016177 15:64349407-64349429 GTGTGGGTATACTGGGTAGAGGG - Intronic
1128119401 15:65134529-65134551 GAGAGTGTCTGGTGGAGAGAAGG - Intergenic
1128334815 15:66779098-66779120 GAGTGGGGTGGCTGGGGAGAGGG + Intronic
1129256889 15:74338850-74338872 GAGTGGGAGTGGTGGTGAGAGGG - Intronic
1129293053 15:74583352-74583374 GAGTGGGTAGGGTGGAGGGATGG + Intronic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129464251 15:75715129-75715151 GAGGGGGTGGGGGGGGGAGATGG - Intergenic
1129678528 15:77645158-77645180 GAGTGTGTATGTTTGGGAGGAGG - Intronic
1130200933 15:81826253-81826275 GAGTGGGTGAGGTGGGGTGGGGG + Intergenic
1130899853 15:88199102-88199124 GACAGGGTGGGGTGGGGAGAAGG + Intronic
1131108239 15:89749028-89749050 TAGAGGGTGCGGTGGGGAGAAGG - Exonic
1131375244 15:91917711-91917733 GAGTGGTTATGGTGGAGGAAGGG + Intronic
1131527242 15:93162269-93162291 GAGTGTGTCTGGTGGGGAGGGGG - Intergenic
1131686790 15:94776941-94776963 GTGTGTGTATGGGGGGGAGGGGG - Intergenic
1132270631 15:100520772-100520794 GAGTGGGCAGGGTGGGGAGGAGG + Intronic
1132389500 15:101428117-101428139 GAGTGGGGTTGGTGATGAGAGGG - Intronic
1132478202 16:153056-153078 GAGTGGGGACAGTGGGGAGGGGG + Intronic
1132480151 16:163268-163290 GAGTGGGGACAGTGGGGAGCGGG + Intronic
1132569680 16:638612-638634 GAGTGGGGAAGGTGGGGGCAGGG + Intronic
1132666564 16:1083597-1083619 GAGTGGGTGGGGTGGGGACGGGG + Intergenic
1132698773 16:1213428-1213450 GAGTGGGTATGAAGCTGAGATGG - Intronic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132841186 16:1979183-1979205 GGGTGGGCACGGTGGGGGGAGGG + Exonic
1133031772 16:3014451-3014473 GGGTGGGGATGTTGGGGAGAGGG - Exonic
1133314259 16:4872465-4872487 GGGTGGGCATGGTGGGGGGGCGG + Intronic
1133646185 16:7766861-7766883 GAGGGGGTAAGATGGGGAGAAGG - Intergenic
1133870795 16:9684043-9684065 GATGGGCTAGGGTGGGGAGATGG + Intergenic
1133894450 16:9912504-9912526 AAGTGGGTGGGGTGGGGGGAGGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134271735 16:12739010-12739032 GAGTGGGTTTGGGAGGGAGGCGG + Intronic
1134297952 16:12963232-12963254 GAGTGGGAATGGTGAGGACATGG + Intronic
1134821654 16:17251915-17251937 GAGTGGGAGTTGTGGGGACAGGG + Intronic
1135173621 16:20208851-20208873 GGGTGGGTATTGAGGGGACAGGG + Intergenic
1135664239 16:24322431-24322453 GAGTGTGTTTAGTGGGGAGGGGG - Intronic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1136543755 16:30943852-30943874 GAGGGGGCATGGTGGGAAGAAGG - Intronic
1137018458 16:35398572-35398594 GAGTTGGGGTGGTGGGGATATGG + Intergenic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1137601592 16:49760026-49760048 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601617 16:49760139-49760161 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601637 16:49760228-49760250 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137700620 16:50495403-50495425 GAGAGGCTATGAAGGGGAGAGGG - Intergenic
1137848550 16:51715304-51715326 AAGGGGGTAGGGTGAGGAGAGGG + Intergenic
1138184261 16:54964131-54964153 CAGTGGGTGTGCTGGGGAGTGGG + Intergenic
1139140229 16:64253561-64253583 TAGTGGATATGGTGGGCAGGTGG - Intergenic
1139527614 16:67526439-67526461 GGGTGGGCATGGTAGGGGGAGGG + Intronic
1139745628 16:69072345-69072367 GAGTGGGTATGGCTGTGAGTAGG - Intronic
1140222072 16:73050899-73050921 GAGTGGGTAAGGGGAGGAGTAGG - Intronic
1141028791 16:80570702-80570724 GAGTGGGGAGGGTGGAGAGGTGG - Intergenic
1141033736 16:80610986-80611008 TGGTGAGGATGGTGGGGAGAGGG - Intronic
1141285788 16:82670356-82670378 CAGTGGGGAAGGTGGAGAGAAGG - Intronic
1141619218 16:85227980-85228002 GAGGGGGTGTGGTGGGGAGCAGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142698666 17:1646889-1646911 GAGTTTGTATGTTGGGGAAAGGG - Exonic
1144128941 17:12227249-12227271 GAGTGGGAGAAGTGGGGAGATGG - Intergenic
1144206431 17:12982895-12982917 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
1144386221 17:14751363-14751385 GAGAGGGTAAGGTGGGGGAATGG - Intergenic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144764759 17:17726281-17726303 GTGTGGGAAGGGTGGGGAGCAGG - Intronic
1145925625 17:28644855-28644877 GAGTGGGTAGGGTGGAGGGAGGG - Intronic
1146173970 17:30653042-30653064 GAGAGGGATTGGTGTGGAGATGG + Intergenic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1146803264 17:35844487-35844509 GAGAGGCTACGGTGGAGAGAGGG + Exonic
1146934642 17:36805147-36805169 GAGTGTGTATTGTGGGGCGGGGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147188667 17:38726310-38726332 GAGTGCCGAGGGTGGGGAGATGG + Exonic
1147306294 17:39566706-39566728 GAGTGTCTTAGGTGGGGAGAGGG - Intergenic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147326185 17:39670811-39670833 GAGTGGGGATCATGAGGAGATGG + Intergenic
1147334768 17:39720574-39720596 AAGGGGGTATGGAGAGGAGAGGG + Intronic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1147662605 17:42125081-42125103 GGGTGGGTAAGGGGGGGAGTGGG - Intronic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1148086528 17:44996926-44996948 GAGAGGGGATGGTGGGAACACGG + Intergenic
1148243486 17:46014969-46014991 GTGAGGGGATGGTGGGGGGATGG + Intronic
1148258123 17:46154744-46154766 GAGAGGGTGTGGTGGGGGGAAGG + Intronic
1148343507 17:46888234-46888256 GTGTGGGTCAGGTGGGGAGTTGG + Intergenic
1148892705 17:50819638-50819660 GAGAGGGTGTGGTGGGGGCAGGG + Intergenic
1148984991 17:51613396-51613418 GAGAGGGAGAGGTGGGGAGAGGG - Intergenic
1149085157 17:52708039-52708061 GTGTGGGGTTGGTGGGGAGGTGG + Intergenic
1149101562 17:52912476-52912498 GAGTTGGGAGGGTGGGAAGAGGG + Intergenic
1149429702 17:56587976-56587998 GACAGTGTATGGTGGGGAGCGGG + Intergenic
1149449808 17:56740785-56740807 GAGAGGGTTGGGTGGGGGGAAGG - Intergenic
1150229662 17:63543248-63543270 GAGAGGGGATGGTGTGGGGAGGG - Intronic
1150410473 17:64937250-64937272 GAGTGGTGGGGGTGGGGAGAAGG + Intergenic
1150561905 17:66302293-66302315 GAGTGGGGATGCGGGGGAGGAGG - Intergenic
1151013760 17:70531102-70531124 GGGTGGGGATGGTGGGGTGGAGG + Intergenic
1151013802 17:70531188-70531210 GGGTGGGGATGGTGGGGTGGAGG + Intergenic
1151167044 17:72213075-72213097 TAGTGGGTGGGGTGGGGAGTAGG - Intergenic
1151320572 17:73350026-73350048 GATTGGGCATGGTGGGGACTGGG + Intronic
1151734076 17:75927892-75927914 GAGTGTGTGTGGTGGGGTAAGGG - Intronic
1152295324 17:79463928-79463950 CAGTGGCGATGGTGGGGAGGTGG - Intronic
1152783146 17:82235319-82235341 GAGTGGGTGGGGTGGGGAAGTGG - Exonic
1152799313 17:82323561-82323583 GAGTGGGTTTGGTGACTAGAGGG + Intronic
1152819627 17:82430160-82430182 GACTTGCTGTGGTGGGGAGAGGG - Intronic
1153613072 18:6907649-6907671 GATAGGGTAGGATGGGGAGAAGG + Intronic
1153640899 18:7156179-7156201 GAGTGGGTGTTGAGAGGAGATGG - Intergenic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1154942130 18:21124574-21124596 GAGAGGGTAAGGTGGGGTCAAGG + Intergenic
1155069376 18:22300488-22300510 GATTGGGTGGGGTGGGGGGAGGG - Intergenic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1156102174 18:33609668-33609690 TAGTGGGTGAAGTGGGGAGAGGG - Intronic
1157516688 18:48316336-48316358 GAGGAGGAGTGGTGGGGAGATGG - Intronic
1157580709 18:48772418-48772440 GAGAGGGTTTGGTGGGGTGCCGG - Intronic
1157778809 18:50419570-50419592 GAGTAGGGAGGGTGGGAAGAGGG - Intergenic
1157966542 18:52215231-52215253 GTGTGTGTGTGGTGGAGAGAAGG - Intergenic
1158403938 18:57144778-57144800 GGGTGGGTGTGGTGGGGGAATGG + Intergenic
1158531802 18:58269209-58269231 GAGTGTGTTAGCTGGGGAGATGG + Intronic
1159289362 18:66396107-66396129 GAGTGGGGGTGGTGGGGTGGTGG - Intergenic
1159793087 18:72808458-72808480 GTGTGTGTGTGGTGAGGAGATGG + Intronic
1160738161 19:674184-674206 GCCTGGATAGGGTGGGGAGAGGG + Intergenic
1160918058 19:1507077-1507099 GAGGGGGGAGGGTGGGGACAGGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161449772 19:4338635-4338657 GACCGGGTAAGGTGGGGAGGCGG - Exonic
1161779613 19:6282744-6282766 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
1161846342 19:6713732-6713754 GAGTGGGGAAGGTGGGGGGCTGG - Intronic
1161849377 19:6730831-6730853 GAGAAGGGATGGAGGGGAGATGG - Intronic
1161983764 19:7643400-7643422 GAGTGGGTCTTGTGGAGAAACGG + Intronic
1162156387 19:8680934-8680956 GAGTGAGTAAGGGGGAGAGAGGG + Intergenic
1162373404 19:10291812-10291834 GAGTGGGTGTGGGGAGGAGATGG + Intronic
1162412632 19:10515621-10515643 GTGTGTGTTTGGTGGGGAGGGGG - Intronic
1162774361 19:12969991-12970013 GGGTGGGTGTGGGGAGGAGAGGG + Intronic
1162963947 19:14146789-14146811 GAGTGGCTGTTGTGGGGAGGTGG + Intergenic
1162988444 19:14286994-14287016 GAGAGGGATTGGTGTGGAGATGG - Intergenic
1163156830 19:15444245-15444267 GTGGAGGTAGGGTGGGGAGAGGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163672180 19:18636024-18636046 GGGTGTGCAGGGTGGGGAGAGGG + Intergenic
1163680841 19:18681458-18681480 GAGTGGGTGGGGTTGAGAGAAGG + Intergenic
1163744101 19:19034523-19034545 GAGTGGGTGTGGCTGGTAGAGGG + Intronic
1163883242 19:19945345-19945367 GAGTGGGTAAGGGGTGGTGATGG - Intergenic
1164524140 19:29001096-29001118 GGGTGGGGGAGGTGGGGAGAGGG + Intergenic
1164575029 19:29400888-29400910 ATGTGGGCATGGTGGGGACAGGG + Intergenic
1164788670 19:30957889-30957911 GAGGGGGAATGGCGGGGAGGAGG + Intergenic
1164799262 19:31062477-31062499 GAGGTGGGATGGTGGGGAGGGGG + Intergenic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1165149869 19:33753987-33754009 GATGGGGGATGGTGGGGGGATGG - Intronic
1165149879 19:33754005-33754027 GAGGGGGGATGGTGAGGAGATGG - Intronic
1165235342 19:34416323-34416345 AACTGGGTGTGGTGGGGAGGTGG + Intronic
1165309854 19:35023346-35023368 GAGTGGGTAGCCTGGGGAAATGG + Intronic
1165706521 19:37980094-37980116 AAGTGGGAGTGATGGGGAGAGGG - Intronic
1165834335 19:38745103-38745125 AAGAGGGTGGGGTGGGGAGAGGG - Intronic
1166035425 19:40164790-40164812 GGGAGGCTTTGGTGGGGAGAGGG - Intergenic
1166281278 19:41795854-41795876 GAGAGGCTATGGTGGGAGGATGG - Intergenic
1166633049 19:44424856-44424878 GAGTGGGTTGGTAGGGGAGATGG - Intronic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167161047 19:47767218-47767240 ACGTGGGTGGGGTGGGGAGAAGG - Intergenic
1167217159 19:48172126-48172148 GGGTGGGTGTGGGTGGGAGACGG + Intronic
1167284512 19:48591584-48591606 GTGTGCGGATGGTGAGGAGAGGG - Intronic
1167423509 19:49417354-49417376 GAGTGACTCTGGTGGGGAGGTGG - Exonic
1167516153 19:49924343-49924365 GAGTAGGGGTGGTGTGGAGAGGG - Intronic
1167529174 19:50004288-50004310 GAGAGAGCAGGGTGGGGAGAGGG - Intronic
1167566676 19:50261406-50261428 GAGTGGGGGTGGTGAGGAGGGGG - Intronic
1168099542 19:54133928-54133950 GAGAGGGGAAGGTGGAGAGAGGG - Intergenic
1168144113 19:54409914-54409936 GAGTGGATGTGGTGGGGATGAGG - Intergenic
1168322422 19:55518152-55518174 GAGGGGTTGTGGTGGGGTGAGGG - Exonic
924994129 2:341334-341356 GAGTGGGTGTAGGTGGGAGAGGG - Intergenic
926152629 2:10433266-10433288 GTGTGGGAATGGTGTGGGGATGG + Intergenic
926223777 2:10953316-10953338 GAGTGGGTAAAGAGGGGATAGGG + Intergenic
926232933 2:11018623-11018645 GGCAGGGTATGGCGGGGAGACGG - Intergenic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
927492247 2:23528342-23528364 GATTGGGTGTTGTGGGGCGAGGG + Intronic
927868470 2:26608261-26608283 GAGTGGGTCTGGTGAGAAGGGGG + Intronic
927941097 2:27103260-27103282 CAATGGGTATGCTGGGTAGAAGG - Intronic
928025561 2:27736088-27736110 GAGGGGGAAAGGTGGGGAGCAGG - Intergenic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928129247 2:28637761-28637783 GAGTGGGCAAGGAGGTGAGAAGG - Intronic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
928421657 2:31141733-31141755 GAGCGAGAATGATGGGGAGACGG - Intronic
929597251 2:43184115-43184137 GAGTGGGAGTGGTGGGGTGGGGG - Intergenic
929651240 2:43681773-43681795 GATGGGGCCTGGTGGGGAGAGGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929911633 2:46094633-46094655 GGGTTGGGAGGGTGGGGAGAGGG + Intronic
929918546 2:46155794-46155816 CAATGGGGATAGTGGGGAGAAGG - Intronic
929986137 2:46734691-46734713 GATTGGGTATGATGAGGACAGGG - Intronic
930130963 2:47850148-47850170 GAGTGGGTATGGTGGGCTGGGGG + Intronic
931083692 2:58804773-58804795 GAGTGGGTTAGGTGGGGTGTTGG + Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931177808 2:59870997-59871019 GAGTGGGCAGGGTGAGGACAAGG - Intergenic
931344319 2:61432232-61432254 GAGTGGCCAAGGTGGGCAGATGG + Intronic
931348089 2:61465193-61465215 GGGTGGGTGTGGTGGGGCAAGGG + Intronic
931460544 2:62446795-62446817 TGGAGGGTAAGGTGGGGAGAGGG + Intergenic
931881286 2:66573969-66573991 GAGGAGGTGTGGTGGGGAGAGGG + Intergenic
931950236 2:67354089-67354111 GAGTGGATAGTGTTGGGAGAAGG + Intergenic
932030768 2:68182077-68182099 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932386941 2:71343777-71343799 GAGTTTTTTTGGTGGGGAGAGGG - Intronic
932411247 2:71549297-71549319 GGGTGGGCATGGCTGGGAGAAGG - Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932495571 2:72144312-72144334 GAGTGTGTTTGGTGGGGAGAGGG - Intronic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932606550 2:73169503-73169525 CAGGAGGTCTGGTGGGGAGAGGG + Intergenic
932622967 2:73277020-73277042 GAGAGGGCAGGGTGGGGAGAAGG - Intronic
932657152 2:73620060-73620082 GAAAGGGGATGGTGGGGAGTGGG + Intergenic
932663825 2:73680303-73680325 GAAAGGGGATGGTGGGGAGTGGG + Intergenic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933426260 2:82115692-82115714 GAGAGGGTGTGGTGGGCAGCAGG - Intergenic
933767952 2:85723620-85723642 GAGTGGGTATGAAGCAGAGATGG + Intergenic
933925876 2:87090932-87090954 CAGGAGGTCTGGTGGGGAGAGGG - Intergenic
933980220 2:87543159-87543181 GGGTGGGTAGGGTGAGGGGAGGG + Intergenic
934893365 2:98089509-98089531 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
935810723 2:106794491-106794513 GAGTGAGGATTCTGGGGAGATGG + Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936313606 2:111407632-111407654 GGGTGGGTAGGGTGAGGGGAGGG - Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936777098 2:115986750-115986772 GTGTGGGTGTGGTGGGGGAAAGG + Intergenic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937857691 2:126684468-126684490 TAGTGGGCATGGTGGTGGGAGGG - Intronic
937887704 2:126911407-126911429 GTGAGGGTGTGGTGGGGTGAGGG - Intergenic
937981745 2:127619867-127619889 GAGTAGGAATGGTCAGGAGATGG + Intronic
938069262 2:128299926-128299948 GGGTGGCTCTGGTGGGCAGAGGG + Intronic
938985816 2:136575181-136575203 GAAGGGGTATGTTGGGGAGTGGG - Intergenic
939216940 2:139250648-139250670 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
939564302 2:143768528-143768550 GAGTGAGTGTGGTTGGGAGTAGG + Intergenic
939639029 2:144617205-144617227 CAGGGGGTGTGGTGGGGGGAGGG - Intergenic
940589118 2:155697842-155697864 GAGGGTGAATGGTGGGAAGAGGG - Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941328142 2:164143395-164143417 GAGTGGGCATGGTGGGCCCATGG + Intergenic
941347467 2:164388208-164388230 GAGTGAGGCTGGTGGAGAGAAGG - Intergenic
941483511 2:166048345-166048367 GAGTGTGCAAGGTGGGAAGAGGG - Intronic
941541396 2:166790142-166790164 GAGGGGGGAAGGTGGGAAGAGGG - Intergenic
941650196 2:168084172-168084194 AGGTGGGCATGGTGGGGGGAAGG + Intronic
941943575 2:171070410-171070432 GAGTGGTGGTGGTGGGGAGGGGG - Intronic
942305041 2:174599196-174599218 GAGTGGGAATGGTGGGGGCAGGG + Intronic
944053304 2:195496000-195496022 GAGTGAGTGGGGTGGGGAGGTGG - Intergenic
944277195 2:197852247-197852269 CAGGGAGGATGGTGGGGAGATGG + Intronic
944839137 2:203608646-203608668 GAGGGAGTATGGAGGGGAGGGGG - Intergenic
944912776 2:204326710-204326732 GAGTGTGTATTGAGGGTAGAGGG + Intergenic
945846255 2:214948516-214948538 CAGTGGGTGTGGTGGGGTGGGGG + Intronic
946431961 2:219630919-219630941 GTGTGGGTGGGGTGGGGGGAAGG + Intronic
946537377 2:220646525-220646547 GAGTGGGGGTGGTCAGGAGAAGG + Intergenic
946539747 2:220671119-220671141 GGGGGGGTGTTGTGGGGAGATGG + Intergenic
946818440 2:223605268-223605290 GAGTGTGGATGGTGGGAGGAGGG - Intergenic
947189505 2:227487731-227487753 GGGTGGGTAGGGTGGGGTGTGGG + Intronic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947771325 2:232672626-232672648 GAGTGGACAGGGTAGGGAGATGG - Intronic
947859213 2:233347129-233347151 GAGTGGGAGGGTTGGGGAGAGGG + Intergenic
947959231 2:234221181-234221203 AAATGGGTATGGTGGAGACAGGG - Intergenic
948091784 2:235301725-235301747 GAGGGGGGATGAGGGGGAGAAGG - Intergenic
948163569 2:235844284-235844306 GAGTGGGTTTGGAGGGGGCAAGG + Intronic
948379879 2:237544073-237544095 GAGTGGGCACGGTGGTGAGTGGG + Intronic
948380052 2:237544715-237544737 GAGTGGGCACGGTGGTGAGTGGG + Intronic
948722607 2:239911054-239911076 TAGTGGGTCTGCTGGGCAGAGGG + Intronic
1169025668 20:2369158-2369180 GGGTGGGCAGGGTGGGGGGAGGG - Intergenic
1169208008 20:3750620-3750642 GAGTGAGTAGGGTGGAGATAAGG + Intronic
1170220365 20:13935620-13935642 GAGTGAGTGGGGTGGGGAGAGGG + Intronic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170604227 20:17863793-17863815 GAGTGGGGTGGGTGGGGAGCTGG - Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170853123 20:20021941-20021963 GAATGGGGATGGTGGGGACAGGG + Intronic
1170950321 20:20930778-20930800 GGGAGGGGATGGTGGGGATAAGG - Intergenic
1170950329 20:20930798-20930820 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950338 20:20930818-20930840 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950347 20:20930838-20930860 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950356 20:20930858-20930880 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950365 20:20930878-20930900 GAGAGGGCATGGTGGGGATAGGG - Intergenic
1171255976 20:23689227-23689249 GAGTGGGGAGGAGGGGGAGATGG - Intergenic
1171263324 20:23751124-23751146 GAGTGGGGAGGAGGGGGAGATGG - Intronic
1171779097 20:29402529-29402551 GAGGGGGGAAGGTGGGAAGAGGG + Intergenic
1172029415 20:31971190-31971212 CAGTGTGTATTGTGGGGAAAAGG + Intronic
1172160591 20:32865349-32865371 GCTTGGGGATGGTGGGGAGCAGG + Intronic
1172215085 20:33230034-33230056 GTGTGTGTGTGGTGGGGTGAGGG - Intergenic
1172359174 20:34300426-34300448 GAGTGGGGAAAGTGGAGAGATGG - Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173215915 20:41083299-41083321 ATGTGGGTATGTTTGGGAGAAGG - Intronic
1174299175 20:49569119-49569141 GAATGGGGATGGTGGGGGCAGGG - Intergenic
1174306479 20:49617437-49617459 GAGAGGGTGGGGTGAGGAGAGGG - Intergenic
1174306485 20:49617453-49617475 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306499 20:49617503-49617525 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306523 20:49617586-49617608 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306533 20:49617619-49617641 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306543 20:49617652-49617674 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306549 20:49617668-49617690 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306559 20:49617701-49617723 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306569 20:49617734-49617756 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174560436 20:51427191-51427213 TGGTGGGTTTGGTGGTGAGATGG + Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175178258 20:57126820-57126842 GGGTGGGCCTGCTGGGGAGAGGG + Intergenic
1175238098 20:57526640-57526662 GAATGGATAAGGAGGGGAGAAGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175374572 20:58515360-58515382 GTTTGGGTGTGGTGGGGAGCGGG - Intergenic
1175871937 20:62213134-62213156 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175872029 20:62213354-62213376 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175872039 20:62213378-62213400 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175890592 20:62314192-62314214 GAGTGGGCATGGAGAGGTGAAGG + Intronic
1176289864 21:5038084-5038106 GAGGGGGGACAGTGGGGAGAGGG - Intronic
1176845646 21:13874517-13874539 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1176848378 21:13894071-13894093 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1177173388 21:17677964-17677986 TAGTGGGTATCATGGAGAGAGGG + Intergenic
1177272192 21:18864105-18864127 GAGGGTGTAGGGTGGGAAGAGGG - Intergenic
1178076583 21:29018476-29018498 GAGTGAGTAAAGTTGGGAGAGGG + Intronic
1178408400 21:32344860-32344882 GAGTGGGTAGTGTGGGGAGCAGG - Intronic
1178518554 21:33268112-33268134 GAGGGGGTAGGGTGGGCACATGG - Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179117275 21:38505347-38505369 GAGAGGGTGAGGTGTGGAGAGGG - Intronic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1179867387 21:44225555-44225577 GAGGGGGGACAGTGGGGAGAGGG + Intronic
1180049400 21:45324434-45324456 GAGGGGGTAAGGTGGGGTGAAGG + Intergenic
1180313994 22:11261958-11261980 GGGTGGGTGGGGTGGGGTGAGGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181467402 22:23117595-23117617 CAGTGGGTGTGGCGTGGAGAGGG + Intronic
1181528694 22:23503858-23503880 GACTGGATATGGTGGGGTGTTGG - Intergenic
1182344439 22:29651122-29651144 GTGTGGGTATAGTAGGGAGGGGG + Intronic
1182980108 22:34661820-34661842 CAGTGGGTATGGTGTGGGGAAGG - Intergenic
1183383106 22:37500339-37500361 GTGAGGCTATGCTGGGGAGACGG + Intronic
1183468549 22:37993058-37993080 GAGTGGGGAAGGTGGAGGGAAGG + Intronic
1183485462 22:38085752-38085774 GGGCTGGTTTGGTGGGGAGAGGG + Intronic
1184023521 22:41836822-41836844 GTATGTGTATGGTGGGGATAAGG + Intronic
1184410442 22:44323106-44323128 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184410533 22:44323519-44323541 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184460546 22:44635305-44635327 GAGGGGGCATGGCAGGGAGAAGG + Intergenic
1184608201 22:45586330-45586352 GAGACAGCATGGTGGGGAGAGGG + Intronic
1184838813 22:47040535-47040557 GTGTGGCTCTGATGGGGAGAGGG + Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185321190 22:50200928-50200950 GAGTGGGGCGGGTGGGGGGAGGG - Intergenic
949340053 3:3019722-3019744 GTGTGTATATGGTAGGGAGAAGG + Intronic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
949607349 3:5668289-5668311 GAGAGGGGAGGGTGGGAAGAGGG + Intergenic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950630203 3:14277120-14277142 AAGTGGGGAGGGTGGGGGGAGGG - Intergenic
950903411 3:16516477-16516499 GATGGGGTCTGGTGGGAAGAAGG - Intergenic
952467021 3:33599757-33599779 CAGCGGGTAGGGTGGGGTGAAGG + Intronic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953501219 3:43436488-43436510 GGGAGGGTAGGGTGAGGAGACGG + Intronic
953583909 3:44182419-44182441 AAGTGGGTATAGTGGGGAAGGGG + Intergenic
953921764 3:46956807-46956829 GGGTGGGTGTGGTGGTGACAGGG - Intronic
954593732 3:51806216-51806238 GAGTGGGAGAGGTGGTGAGAAGG + Intergenic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954714580 3:52520716-52520738 GAGTGGGGGTGGTGGGGTGGGGG + Intronic
955000461 3:54922796-54922818 GAGTGAGTGTGTTGGGGAGGTGG - Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955156431 3:56421327-56421349 GTGTGGGTAAGGTGGTGAGGAGG - Intronic
955156820 3:56425199-56425221 GTGTGTGTTTTGTGGGGAGATGG - Intronic
955363548 3:58293093-58293115 GGGGTGGCATGGTGGGGAGAAGG - Intronic
955517921 3:59746488-59746510 GAGAGGGGAGGATGGGGAGATGG + Intergenic
956167720 3:66408952-66408974 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
956218546 3:66877135-66877157 GATTTGGGATGGTGGGGGGAGGG + Intergenic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956788526 3:72662398-72662420 GGGTGGGCATGATGGGGGGAGGG - Intergenic
957760664 3:84551607-84551629 GGGTGGGTCTGTTGGGGGGAGGG + Intergenic
958421414 3:93936082-93936104 GAAGGGGTGTGGGGGGGAGATGG - Intronic
958505659 3:94973895-94973917 AAGTGGAAGTGGTGGGGAGAGGG - Intergenic
958616181 3:96495681-96495703 GATTGAGTATGGGGAGGAGATGG - Intergenic
958723089 3:97870285-97870307 GAGTGGGGAGGATGGGAAGAGGG - Intronic
959006836 3:101029135-101029157 GAGTGTGGAGGGTGGGAAGAGGG - Intergenic
959049285 3:101509138-101509160 GAGTGGGAAAGGGGTGGAGAGGG - Intronic
959136066 3:102422759-102422781 GAGTGGATATGATGGGCATAGGG + Intronic
960058357 3:113293197-113293219 GATTGAGTCTGGTGAGGAGAAGG - Intronic
960158361 3:114321229-114321251 GAGAGGACATGGTGGTGAGATGG + Intergenic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
961075617 3:123979301-123979323 GAGTGGGTGTCCTGGGCAGATGG - Intronic
961094482 3:124142745-124142767 GAGTGGGTGGGGGGTGGAGATGG - Intronic
961224296 3:125225747-125225769 GATTAGGAATGGTGGGGAGAGGG - Exonic
961308068 3:125973207-125973229 GAGTGGGTGTCCTGGGCAGATGG + Intronic
961524949 3:127490780-127490802 GGGTGGGCATGGTGGGGGTAGGG - Intergenic
961564541 3:127754226-127754248 GAGTGAGCTTGGTGGGGAGTGGG - Intronic
962222205 3:133573625-133573647 GAGTGGGGAGGGGAGGGAGAGGG - Intergenic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
963622520 3:147629392-147629414 GAGGTGGTGAGGTGGGGAGATGG - Intergenic
963764238 3:149317088-149317110 GATTTGGGATGGTGGGGACATGG - Intergenic
964164091 3:153680712-153680734 GAGAAGGTATGGTGGGTAAAAGG - Intergenic
964751577 3:160058688-160058710 GAGTGGGGTTGGTGGGGAGTGGG + Intergenic
965298577 3:166979911-166979933 GGGTGGGGGTGGTGTGGAGATGG + Intergenic
965567968 3:170140952-170140974 GGGTGTGCCTGGTGGGGAGAAGG + Intronic
966351361 3:179035505-179035527 GAGTGTGTGTGGTGTGGAGAGGG - Intronic
966591109 3:181683809-181683831 GAGTGTGTGTGGTGGGGAAGTGG - Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967136986 3:186520938-186520960 GACTGGGTAGCATGGGGAGAAGG - Intergenic
967309998 3:188096644-188096666 GAGAGGGCTAGGTGGGGAGAAGG + Intergenic
968051886 3:195660159-195660181 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
968615750 4:1577064-1577086 GAGCGGGTACGGTGGGGACAGGG + Intergenic
968647820 4:1749051-1749073 GAGGGGGCGTGGTGGGGAGGGGG - Intergenic
968647828 4:1749067-1749089 GAGGGGGCACGGTGGGGAGGGGG - Intergenic
968647958 4:1749348-1749370 GAGGGGGCATGGTGGGGAGGGGG - Intergenic
968684151 4:1945223-1945245 GACGGGGTGGGGTGGGGAGATGG + Intronic
969103022 4:4784304-4784326 GTGTGTGTGTGGTGGGGATAAGG - Intergenic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
969447781 4:7255472-7255494 GAGAGGGTGTGCTGGGGAGGCGG + Intronic
969515679 4:7646955-7646977 GAGGGGGTTTGGTGGGAACAGGG + Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971284480 4:25274466-25274488 TAGGTGGTATGTTGGGGAGAGGG + Intronic
971337021 4:25732736-25732758 GTGTGTGTGTGGTGGGGAGTCGG + Intergenic
972249165 4:37281040-37281062 GAGTGGGTCTGGAGGGGCAAAGG + Intronic
972583112 4:40412612-40412634 GGTTGGGTGTTGTGGGGAGAGGG + Intergenic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
973129813 4:46636504-46636526 GAGTGTGTATGTTGGGGATAGGG - Intergenic
973148544 4:46860115-46860137 GAGTTGGTAAGATGGTGAGATGG + Intronic
973563976 4:52165344-52165366 GAGGGGGGAGGGTGGGGGGAGGG - Intergenic
973822746 4:54677243-54677265 GAGTGGGGATGGGGGCGGGAGGG - Intronic
973845756 4:54911507-54911529 GTGTGGGTATGGTGGAGAAGGGG - Intergenic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
974542494 4:63256035-63256057 GGGTGGGTTTGGGGAGGAGAAGG - Intergenic
974791994 4:66703622-66703644 GAATGTTTTTGGTGGGGAGAGGG - Intergenic
975813161 4:78190597-78190619 GAAGGGGTGTGGTGGGGGGATGG - Intronic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976183059 4:82417425-82417447 GACTGGGGAGGGTAGGGAGAAGG - Intergenic
976609784 4:87018499-87018521 AAGTGGTGATGGTGGTGAGAAGG + Intronic
977202303 4:94131411-94131433 GTGTGGATATGCTGGGGAAAGGG + Intergenic
977229180 4:94431585-94431607 GAGAGGCTAAGGTGGGCAGATGG - Intergenic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
979566264 4:122157412-122157434 GGGTGGGGTTGGTGGGGGGATGG + Intronic
980169462 4:129271337-129271359 GACTGGGAAGGGTAGGGAGAAGG - Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
981002324 4:139839819-139839841 TAGTGGATATGAAGGGGAGATGG + Intronic
981099011 4:140810743-140810765 GAGAGGGAAAGGTGGGGAGAGGG - Intergenic
981099019 4:140810767-140810789 GAGAGGGAAAGGTGGGGAGAGGG - Intergenic
981408664 4:144401827-144401849 GAGAGGGTATGGTAGGCACAGGG + Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982705116 4:158700545-158700567 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
983092008 4:163514980-163515002 GAGGGGGTTTGGTGGGGGGTAGG + Intronic
983804183 4:171973075-171973097 GTGTGTGTATGTTGGGGAGGAGG - Intronic
984364945 4:178786299-178786321 TAGGGGGTGTGGTGGGGGGAGGG + Intergenic
984815369 4:183831128-183831150 GAGGGGGGATGGTGGGGGGATGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
986384239 5:7216206-7216228 GAGTGGGCATGGGGTGGAGGGGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987040849 5:14060934-14060956 GACTGGCTATGATGGTGAGAGGG + Intergenic
987591411 5:19932555-19932577 GTGTGTGTATTGTGGGGAGAGGG - Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
988735478 5:34016215-34016237 GTGCGGGGGTGGTGGGGAGAGGG + Intronic
988774986 5:34469393-34469415 GATTGAGTTTGGTGGGGAAAGGG + Intergenic
988854927 5:35219126-35219148 GAGTTGGACTGGTGGGGAGATGG - Intronic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
990480120 5:56202144-56202166 GAGGGGGTGGTGTGGGGAGAGGG + Intronic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
991168756 5:63595052-63595074 CAGAGGGTGTTGTGGGGAGAAGG + Intergenic
992173070 5:74123151-74123173 AATGGGGTAGGGTGGGGAGAAGG + Intergenic
992285937 5:75235896-75235918 AAGTGGGTATGATGAGGAAAGGG + Intronic
992653838 5:78888649-78888671 GAGTGGAGATGATGGGGACAAGG + Intronic
992910785 5:81394146-81394168 GAGCGGGCATGGTGGGGTGTCGG - Intronic
993020372 5:82584495-82584517 GAGTGGGTATGCTGTGCTGAAGG + Intergenic
994299309 5:98127377-98127399 GTGGGGGTAGGGTGGAGAGAGGG + Intergenic
994353091 5:98769107-98769129 GATTGAGTGTGGTGGGGGGAAGG + Intronic
995340881 5:111057833-111057855 GTGTGGGTATGGTGGACAAAGGG + Intergenic
995381937 5:111545058-111545080 GAGAGGATATGGTGGGGACAGGG - Intergenic
995782499 5:115793297-115793319 GACAGGGTATTGTAGGGAGATGG - Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996783003 5:127208838-127208860 GAAGGGGTATGCTGGGGAGGTGG - Intergenic
996850445 5:127945769-127945791 GAGGGTGGAGGGTGGGGAGAGGG - Intergenic
997235172 5:132268348-132268370 GAGTGGGGGTGTTGGGGAGGGGG + Intronic
997643895 5:135467499-135467521 CAGAGGGTAGGGTGGGGAGGAGG + Intergenic
997737955 5:136228283-136228305 GAGTGGGTGGGGTGGGGGGTAGG + Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998108908 5:139486310-139486332 GAGTGGGAATGGTGGGGTCCAGG + Intergenic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999019215 5:148144605-148144627 GAGTGGTTATGTTAGGAAGAGGG - Intergenic
999312099 5:150558063-150558085 GGGTGGGGAGAGTGGGGAGAGGG + Exonic
999480622 5:151944932-151944954 GAGTGGAAAGGGTGGGGTGAGGG - Intergenic
999494434 5:152083267-152083289 GAGCTGGTTTGGTGGGAAGAAGG + Intergenic
999750331 5:154623845-154623867 AAGTGGGCATGGTGGGGTGGGGG - Intergenic
1000132930 5:158317602-158317624 GAGGGAGTGTGATGGGGAGAGGG - Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1000867754 5:166536598-166536620 GAGTTGGTGAGGTGGAGAGAAGG + Intergenic
1001494029 5:172175373-172175395 AGGTGAGTATGGTGGAGAGAGGG + Intronic
1001566961 5:172706082-172706104 TGGTGGCTGTGGTGGGGAGAAGG + Intergenic
1001569233 5:172719238-172719260 GTGGGGCTATGGTGGGGAAAAGG + Intergenic
1001629982 5:173167907-173167929 GGGTGGGTATGGGCGGGAGATGG - Intergenic
1001865601 5:175102135-175102157 AAAAGGGTATGTTGGGGAGAGGG + Intergenic
1001866108 5:175106953-175106975 GAGTGGACATGGTGGGTAGAGGG - Intergenic
1002475387 5:179462185-179462207 GTGTGGGCGTGGTGGGGGGAGGG - Intergenic
1004244218 6:13956911-13956933 GTGTGTGTATGGTGGGGGGCGGG - Intronic
1004271396 6:14199224-14199246 GAGTGGGGAAAGTTGGGAGAAGG + Intergenic
1004558652 6:16725974-16725996 ATGTGGGTATTGTGGGGAGGAGG - Intronic
1004620380 6:17326027-17326049 GAGCGGGTATGACGTGGAGATGG + Intergenic
1004650420 6:17602035-17602057 AAGTGGGGAGGGTGGGGACAAGG + Intronic
1005379417 6:25218242-25218264 GGGTGGGGGTGGTGGGGAGCAGG - Intergenic
1006133592 6:31882848-31882870 GAAAGGGTGAGGTGGGGAGAGGG + Intronic
1006378603 6:33685081-33685103 GAGTGGGCATGATGGGGGCAGGG + Intronic
1006456488 6:34134914-34134936 GAGTGGGGAGGCTGGGGTGAGGG - Intronic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007182027 6:39935820-39935842 AACTGGGTATGGGGGAGAGAAGG + Intergenic
1007208614 6:40172974-40172996 GTGGGGGGATGGTGGTGAGAGGG - Intergenic
1007277878 6:40689046-40689068 GGATGGGAATGGTGGGGAGATGG - Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007693872 6:43719524-43719546 CCCTGGGAATGGTGGGGAGATGG + Intergenic
1007825626 6:44598715-44598737 GATTGGGGTTTGTGGGGAGAGGG + Intergenic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008575457 6:52856395-52856417 GCTTGGGTTTGGTGGGGGGAGGG - Intronic
1008936421 6:56997414-56997436 GTGTGTATGTGGTGGGGAGATGG - Intronic
1009414017 6:63396165-63396187 GGCTGGGTAGGGTGGAGAGACGG + Intergenic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1011130089 6:84043641-84043663 GTGTGTGTATGGGGGGGTGAGGG + Intronic
1011737872 6:90330979-90331001 GAGCGGGCTTGGTGGGGAGGAGG + Intergenic
1011871708 6:91902354-91902376 GAGAGGTTATGGGGGAGAGATGG + Intergenic
1012288467 6:97422264-97422286 GGGTGGGGAGGGTGGGGAGGTGG - Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1012442066 6:99270187-99270209 GAGAGGGGATGGTGGAGATAGGG - Intergenic
1012610018 6:101205805-101205827 GAGTGGGTATGGTGGGGTTCAGG + Intergenic
1012624818 6:101392929-101392951 GCGGGAGTTTGGTGGGGAGAGGG + Intergenic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1012961284 6:105624656-105624678 GAGGGGGTGAGGTGGGGAGGTGG + Intergenic
1013118397 6:107120467-107120489 GAGAGGGTGAGGTGGGAAGATGG - Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014747873 6:125221060-125221082 GAGTGGACAAAGTGGGGAGAGGG - Intronic
1014918769 6:127187102-127187124 CAGCGGGCATGGTGGTGAGATGG + Intronic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1015273184 6:131358121-131358143 GACTGTGAAAGGTGGGGAGAAGG + Intergenic
1015395154 6:132725603-132725625 GAGGGGGGATGGTGGGAGGAGGG - Intronic
1015585809 6:134775103-134775125 GAGTGTGTAGGGTGGGGAAGTGG - Intergenic
1015875594 6:137818859-137818881 GGGTAAGTATGGTGGGGAAAAGG + Intergenic
1017812918 6:157997008-157997030 GGGTGGGGTAGGTGGGGAGACGG - Intronic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1018379526 6:163245673-163245695 CAGAGTGTGTGGTGGGGAGAGGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018839583 6:167508232-167508254 GAGAGGGGATGGGGAGGAGAGGG - Intergenic
1018839710 6:167508574-167508596 GAGAGGGAATGGGGAGGAGAAGG - Intergenic
1018839767 6:167508722-167508744 GAGAGGGGATGGGGAGGAGAGGG - Intergenic
1019125963 6:169840240-169840262 GAGTGGGAGTGGTGTGGAGTGGG - Intergenic
1019125977 6:169840300-169840322 GAGTGGGCATGGTGTGGAGTGGG - Intergenic
1019125981 6:169840316-169840338 GAGTGGGCATGGTGTGGAGTGGG - Intergenic
1019125985 6:169840332-169840354 GGGTGGGTGTGGTGTGGAGTGGG - Intergenic
1019126021 6:169840473-169840495 GAGTGGGCATGATGTGGAGTGGG - Intergenic
1019126050 6:169840606-169840628 GAGTGGGTGTAGTGTGGAGTGGG - Intergenic
1019142401 6:169956983-169957005 GAGGGGGTGTGGTGGGGGGCTGG + Intergenic
1019142441 6:169957086-169957108 GAGGGGGTGTGGTGGGGGGCTGG + Intergenic
1019142455 6:169957120-169957142 GAGGGGGTGTGGTGGGGGGCTGG + Intergenic
1019142469 6:169957154-169957176 GAGGGGGTGTGGTGGGGGGCTGG + Intergenic
1019142518 6:169957292-169957314 GAGGGGGTGTGGTGGGGGGCTGG + Intergenic
1020706631 7:11552158-11552180 GAGGGTGTAAGGTGGGAAGAGGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021224881 7:18015015-18015037 GAGTGGATTTGATGGGCAGAAGG + Intergenic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1022317654 7:29260530-29260552 GGGTGGCCATGGTGGGGCGAGGG + Intronic
1022509352 7:30925359-30925381 GAGTTGTGATGGAGGGGAGAGGG + Exonic
1022520929 7:31006521-31006543 GAGAGGGTGGGGTGGAGAGAAGG - Intergenic
1022812731 7:33885557-33885579 GTGTGTGTTTGGTGGGGGGATGG - Intergenic
1023083653 7:36548534-36548556 GAGTGGAGTTGGTGAGGAGAGGG + Intronic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1024028133 7:45431654-45431676 GCTTGGGGATGGTGGGGAGAGGG + Intergenic
1024639758 7:51318996-51319018 GAGGAAGTATGGTGGGGACATGG + Intergenic
1025996630 7:66531477-66531499 AAGTGGATTTGGTGGGTAGAGGG - Intergenic
1026308287 7:69161502-69161524 GATTAGGTGTGGTGGGGAGGTGG - Intergenic
1026988683 7:74570880-74570902 AAGTGGATTTGGTGGGTAGAGGG - Intronic
1027053151 7:75032219-75032241 GAGTGGGGACGGTGGGGGGAAGG + Intronic
1027261094 7:76465179-76465201 GGGTGGGTAAGGTGAGGACAGGG + Intronic
1027312476 7:76963287-76963309 GGGTGGGTAAGGTGAGGACAGGG + Intergenic
1028168955 7:87572895-87572917 GAGTGTGGAGGGTGGGGGGAGGG + Intronic
1028644969 7:93085853-93085875 GAGAGGGTATGATGGGAATAAGG + Intergenic
1028897720 7:96061002-96061024 GAGAGGGGATTGTGGGGTGAGGG + Intronic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029472019 7:100760603-100760625 GAGTGGGCAGGGTGGGCAGCAGG - Intronic
1029553544 7:101251980-101252002 GACCGGGCATGGTGGGTAGAAGG - Intronic
1029897507 7:104000060-104000082 GAGTGGATCTGGGGAGGAGAGGG - Intergenic
1030106250 7:105989859-105989881 GGGGGTGTATGGTGGGGACAGGG - Intronic
1030107122 7:105996584-105996606 TTTTGGATATGGTGGGGAGAAGG + Intronic
1031866117 7:127039959-127039981 GAAGGGGTATGGAGGGGAAAGGG + Intronic
1032010359 7:128342937-128342959 GCATGTGTATAGTGGGGAGAGGG - Intronic
1032374278 7:131394363-131394385 GGCAGGGTATGGTGGAGAGATGG + Intronic
1033279773 7:139997556-139997578 GTGTGTGTATAGTGGGGGGAGGG - Intronic
1033583672 7:142758826-142758848 GAGGGGGTATGGGGTGGAGAGGG + Intronic
1033718135 7:144024513-144024535 GAGTGGCTTGGGTGGGAAGAGGG - Intergenic
1033877341 7:145838586-145838608 GAGGGTGTAAGGTGGGAAGAGGG + Intergenic
1034077760 7:148249230-148249252 CAGTGGGTTTGGTGGTGAGAAGG - Intronic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1035277345 7:157755728-157755750 GAGGGGGTAGGAAGGGGAGAGGG + Intronic
1035299474 7:157887709-157887731 GAGTGGGTACTGGGGGGAGTAGG - Intronic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035299529 7:157887880-157887902 GAGTGGGTATGGTGGAGAGCAGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035605820 8:929222-929244 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1035605871 8:929384-929406 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1035712478 8:1729302-1729324 GAGTGGGGAAGGTTGGGCGAAGG - Intergenic
1036600453 8:10255915-10255937 TAGCGGGCATGGTGGGGGGATGG - Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1038007527 8:23445315-23445337 GGTAGGGAATGGTGGGGAGATGG - Intronic
1038041503 8:23727587-23727609 GACTGGTTGTGGTGGGGAGAAGG - Intergenic
1038568167 8:28637005-28637027 GAGGGGGTGGGGCGGGGAGAGGG + Intronic
1039822354 8:41145345-41145367 AGGAGGGTAGGGTGGGGAGATGG + Intergenic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1041095403 8:54344285-54344307 GGCTGGGCACGGTGGGGAGATGG + Intergenic
1041100996 8:54396347-54396369 GTGTGGGCATTGCGGGGAGAAGG + Intergenic
1041263174 8:56039153-56039175 GAGTGAGTGTGTTGGGCAGAGGG + Intergenic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1041944020 8:63421873-63421895 AAGTGGTAATGGTGGTGAGAGGG - Intergenic
1042317016 8:67435569-67435591 GAGTGCCGAGGGTGGGGAGATGG + Intronic
1042448841 8:68921277-68921299 GTGTGTGTATGGTGGGGGGGGGG + Intergenic
1042939812 8:74096307-74096329 GAGAGGGAATGGTTGGGGGAAGG - Intergenic
1043261783 8:78209504-78209526 CACTGGGTGTGGTAGGGAGAGGG + Intergenic
1044249695 8:89991186-89991208 GGGTGGGTGGGGTGGGGGGACGG + Intronic
1044483370 8:92719651-92719673 TAGAGGGTAGGGTGGGTAGAGGG - Intergenic
1044514142 8:93118989-93119011 GAGTGGAGATGTTGGGAAGATGG + Intergenic
1044554019 8:93542476-93542498 GAGTGAGTTTGAAGGGGAGAGGG + Intergenic
1044794268 8:95880443-95880465 AGGTGGGTGTGGTGGGGATAAGG + Intergenic
1044803773 8:95983755-95983777 GAGAGGGAATGGAGGGGAGGGGG + Intergenic
1044833889 8:96277311-96277333 TAGTGGAGATGGTGGGGAGTTGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1045127118 8:99104545-99104567 GAGGGGGGACGGTGGGGAGAGGG - Intronic
1045739143 8:105334150-105334172 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1046414600 8:113896256-113896278 GATTGGGTAGGCTGAGGAGAAGG - Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1047188106 8:122653968-122653990 GAGAAGGTGTGGTGGGGAGTGGG - Intergenic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1048259294 8:132931987-132932009 GAGAGGCTAAGGTGGGAAGATGG + Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048290098 8:133174748-133174770 GAAGGGGCATGGTGCGGAGAGGG - Intergenic
1049065991 8:140314596-140314618 GTCTGGGGATGGTTGGGAGAAGG - Intronic
1049221362 8:141430249-141430271 TGGTGGGGATGGTGGGGACAGGG + Intronic
1049221426 8:141430462-141430484 TGGTGGGGATGGTGGGGACAGGG + Intronic
1049406800 8:142455231-142455253 GAGTGGGAGTGATGGGGGGAAGG - Intronic
1049643140 8:143724573-143724595 GAATGGGGCTGGTGGGGAGAGGG + Exonic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050050250 9:1592558-1592580 GAGTGAGTAAGGTGTGGGGATGG + Intergenic
1050977300 9:11956343-11956365 GAAGGGGCATGGTGGGGGGAAGG + Intergenic
1051942777 9:22529147-22529169 GGGTGGGTGGGGTGGGGAAAGGG - Intergenic
1052081936 9:24216905-24216927 GAATGGGTCAGGTGAGGAGAGGG + Intergenic
1052151906 9:25127424-25127446 GAGTGGGGAGGATGGGAAGAGGG + Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052263537 9:26545751-26545773 GAGGGTGTATGCTGGGAAGAGGG + Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052764611 9:32628484-32628506 GAATGGGATTGGAGGGGAGAGGG - Intergenic
1052853153 9:33390374-33390396 TAATGGGTCTGGTGGTGAGAGGG + Intronic
1053056640 9:34996885-34996907 GTGTGTGTGTGCTGGGGAGATGG + Intronic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1053665991 9:40317956-40317978 GGGTGGGTAGGGTGAGGAGTAGG + Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053915572 9:42943001-42943023 GGGTGGGTAGGGTGAGGAGTAGG + Intergenic
1054377147 9:64457984-64458006 GGGTGGGTAGGGTGAGGAGTAGG + Intergenic
1054518619 9:66058327-66058349 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1055827010 9:80339233-80339255 TGGTGGCTATGGTGGGGAGGGGG + Intergenic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056585894 9:87926863-87926885 GGGTGGGTAGGGTGGAGAGTAGG - Intergenic
1056610990 9:88126080-88126102 GGGTGGGTAGGGTGGAGAGTAGG + Intergenic
1056858409 9:90156362-90156384 CAGTGGGTATGATGGGGAGGAGG + Intergenic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057786465 9:98091873-98091895 GAGTGGGGATAGGGTGGAGACGG - Intronic
1057813164 9:98273416-98273438 GAGAGGACAGGGTGGGGAGAGGG - Intergenic
1058758115 9:108102599-108102621 GTGTGTGTATGTTGGGGAGTAGG + Intergenic
1058944216 9:109841653-109841675 GAGAGGGGAGGGTGGGGGGATGG + Intronic
1058983382 9:110190422-110190444 GAGTTCCCATGGTGGGGAGAAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1059541634 9:115136269-115136291 GTGTGTGTATGTTGGGGGGATGG + Intergenic
1059548086 9:115199227-115199249 GACTGGTGATGGTGGGGAGAGGG + Intronic
1059633086 9:116145694-116145716 GAGGGTGTATGGTGGGAGGAGGG + Intergenic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060254397 9:122014473-122014495 GAGTGGGGAAGGTGGGAAGGTGG - Intronic
1060879466 9:127107951-127107973 GAGTGGGCATAGTGGGCAGAGGG + Exonic
1060909986 9:127341853-127341875 GAGAGGGTGTGTTGAGGAGATGG + Intronic
1060961182 9:127681856-127681878 GAATGGGGCAGGTGGGGAGAAGG - Intronic
1061164535 9:128914668-128914690 AAGTGAGGATGATGGGGAGATGG - Intronic
1061306573 9:129736131-129736153 GAGTGGGGATGGGGGAGGGATGG - Intergenic
1061539213 9:131268501-131268523 GAGTGGGGTTGGCAGGGAGAAGG - Intronic
1061587471 9:131578320-131578342 GCGTGGGGAGAGTGGGGAGAGGG + Exonic
1061942553 9:133891409-133891431 GAGGGGGGATGGAGGGGGGACGG + Intronic
1062194130 9:135263876-135263898 GAGAGGGGAAGGAGGGGAGAGGG - Intergenic
1062286967 9:135777695-135777717 GAGTGGGTGTGGGGAGGAGCTGG - Intronic
1062350101 9:136134268-136134290 GAGTGGGAAGGCTGGGGACACGG - Intergenic
1062707553 9:137953794-137953816 CAGAGGGTGTTGTGGGGAGAGGG + Intronic
1185621734 X:1454084-1454106 GGGTGGGAAGGGCGGGGAGATGG + Intergenic
1185709724 X:2293809-2293831 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1185928171 X:4170636-4170658 GAGTGGGCTTGCTGGGGAGGAGG + Intergenic
1186122406 X:6377912-6377934 TAGTGGGGGTGGTGGTGAGAGGG + Intergenic
1186416768 X:9390421-9390443 AAATGGGGATGTTGGGGAGAGGG + Intergenic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1186789075 X:12979402-12979424 GAGTGTGTATGGGGGGGAGGTGG + Intergenic
1187043015 X:15616841-15616863 GAGTGGGCATGGTGGAGGGGCGG - Intergenic
1187434241 X:19252618-19252640 GAGTTGATATAGTGGGGAGTGGG - Intergenic
1187516882 X:19979925-19979947 GAGAGAGAATAGTGGGGAGAGGG + Intergenic
1187636544 X:21235474-21235496 GAGGGGGTAGGGTGGGAGGATGG + Intergenic
1187654849 X:21460070-21460092 GAGTATGTATGGTGGGAAGACGG - Intronic
1187940504 X:24376178-24376200 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
1188007014 X:25022645-25022667 GAGTGGGGGTGGTTGGGAGGAGG - Intergenic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1188554651 X:31398416-31398438 AAGGGGGTAGGGTGGGGAGCAGG + Intronic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189036183 X:37495709-37495731 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189037691 X:37509251-37509273 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189129765 X:38485553-38485575 GAGTGCGGAGGGTGGGGAGAGGG + Intronic
1189311956 X:40025511-40025533 GAGTGGTTAAGGTGGAGAGCGGG + Intergenic
1189422445 X:40868190-40868212 GGCTGGGGAGGGTGGGGAGATGG - Intergenic
1189700694 X:43714774-43714796 GTGTGTGTGTGGTGGGGAAATGG + Intronic
1189865588 X:45323803-45323825 GAGTGGGAAGGGTGGGGATGGGG - Intergenic
1190066098 X:47242723-47242745 GAGTGGGGATGGCAGGGAGGTGG + Intronic
1190260720 X:48795241-48795263 GAGTGGGAATGTTGGGGAAGGGG - Intergenic
1190467140 X:50736401-50736423 TGGGGGGTATGCTGGGGAGATGG - Intronic
1190508638 X:51154685-51154707 CCGTGTGTATGGTGGGGATAAGG + Intergenic
1190826829 X:54025491-54025513 GAAGGGGTGTGTTGGGGAGATGG - Intronic
1190998327 X:55634644-55634666 GAATGTCTATGGTGGGGAGGAGG - Intergenic
1191046242 X:56140602-56140624 GAGGGTGGATGGTGGGAAGAGGG + Intergenic
1191641600 X:63433506-63433528 GATCAGTTATGGTGGGGAGAGGG + Intergenic
1191744209 X:64467982-64468004 GAGTGAGCAGGTTGGGGAGAGGG - Intergenic
1191817324 X:65260415-65260437 GAGGGTGTAGGGTGGGAAGAAGG + Intergenic
1191834465 X:65449152-65449174 GAGAGGGTAGGGTGAGGAGAGGG + Intronic
1191845835 X:65547315-65547337 GAGTGTGTATGGTATGGGGAGGG + Intergenic
1192388771 X:70702697-70702719 AATTAGGGATGGTGGGGAGAAGG - Intronic
1193018817 X:76767701-76767723 GGGAGGGTAAGGTGGGGAGATGG - Intergenic
1193456621 X:81739061-81739083 GAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1194460925 X:94166345-94166367 GGGTGGGGATTGTGGTGAGAAGG + Intergenic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195810627 X:108825058-108825080 GCTTGAGTTTGGTGGGGAGAAGG - Intergenic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196070261 X:111513147-111513169 GAGTGATTATGAGGGGGAGAAGG - Intergenic
1196476897 X:116097762-116097784 GAATGGGTGCTGTGGGGAGACGG + Intergenic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1197272633 X:124442224-124442246 GAGAGGGTGTGGTGGGGTGGAGG + Intronic
1197691610 X:129506854-129506876 GAATGTGGTTGGTGGGGAGATGG - Intronic
1197976847 X:132174865-132174887 GAGTGGGCATAGAAGGGAGATGG + Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1200075336 X:153547881-153547903 GAGCGCGGAGGGTGGGGAGATGG + Exonic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200686828 Y:6265626-6265648 GAGCGGGTCTGCTGGGGAGCGGG - Intergenic
1200828095 Y:7663673-7663695 GAGTGGGGATGGAGTGGGGAGGG + Intergenic
1200989706 Y:9336542-9336564 GAGCGGGTCTGCTGGGGAGCGGG - Intergenic
1200992375 Y:9356875-9356897 GAGCGGGTCTGCTGGGGAGCGGG - Intergenic
1200995026 Y:9377153-9377175 GAGCGGGTCTGCTGGGGAGCGGG - Intronic
1200997691 Y:9397499-9397521 GAGCGGGTCTGCTGGGGAGCGGG - Intergenic
1201000203 Y:9466035-9466057 GAGCGGGTCTGCTGGGGAGCGGG - Intergenic
1201002862 Y:9486345-9486367 GAGCGGGTCTGCTGGGGAGCGGG - Intronic
1201005518 Y:9506628-9506650 GAGCGGGTCTGCTGGGGAGCGGG - Intergenic
1201008181 Y:9526958-9526980 GAGCGGGTCTGCTGGGGAGCGGG - Intergenic