ID: 1154411714

View in Genome Browser
Species Human (GRCh38)
Location 18:14145366-14145388
Sequence CTGGAGGCCTAGAGGCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154411714_1154411721 30 Left 1154411714 18:14145366-14145388 CCTGAGGGCCTCTAGGCCTCCAG No data
Right 1154411721 18:14145419-14145441 GCCACTGCCCTGTCCTATCCAGG No data
1154411714_1154411719 0 Left 1154411714 18:14145366-14145388 CCTGAGGGCCTCTAGGCCTCCAG No data
Right 1154411719 18:14145389-14145411 CATGGCTGACGCTGACAGTGTGG No data
1154411714_1154411720 3 Left 1154411714 18:14145366-14145388 CCTGAGGGCCTCTAGGCCTCCAG No data
Right 1154411720 18:14145392-14145414 GGCTGACGCTGACAGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154411714 Original CRISPR CTGGAGGCCTAGAGGCCCTC AGG (reversed) Intergenic
No off target data available for this crispr