ID: 1154415802

View in Genome Browser
Species Human (GRCh38)
Location 18:14174624-14174646
Sequence CCTGGCACGGAGCAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154415789_1154415802 29 Left 1154415789 18:14174572-14174594 CCCACAGAGAAGCAAGCTGTGGT No data
Right 1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG No data
1154415790_1154415802 28 Left 1154415790 18:14174573-14174595 CCACAGAGAAGCAAGCTGTGGTG No data
Right 1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG No data
1154415793_1154415802 -4 Left 1154415793 18:14174605-14174627 CCAGGTGTCTCCTCCTCCTCCTG No data
Right 1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154415802 Original CRISPR CCTGGCACGGAGCAGCTGGG AGG Intergenic
No off target data available for this crispr