ID: 1154416528

View in Genome Browser
Species Human (GRCh38)
Location 18:14178517-14178539
Sequence CCCAACCCGCTCCCCACGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154416528_1154416537 12 Left 1154416528 18:14178517-14178539 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1154416537 18:14178552-14178574 CCTTGGCTGCACTATTCACACGG No data
1154416528_1154416539 16 Left 1154416528 18:14178517-14178539 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1154416539 18:14178556-14178578 GGCTGCACTATTCACACGGCGGG No data
1154416528_1154416538 15 Left 1154416528 18:14178517-14178539 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1154416538 18:14178555-14178577 TGGCTGCACTATTCACACGGCGG No data
1154416528_1154416534 -5 Left 1154416528 18:14178517-14178539 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1154416534 18:14178535-14178557 TTGGGGGCCTTAAGGATCCTTGG No data
1154416528_1154416541 23 Left 1154416528 18:14178517-14178539 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1154416541 18:14178563-14178585 CTATTCACACGGCGGGGATCAGG No data
1154416528_1154416540 17 Left 1154416528 18:14178517-14178539 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1154416540 18:14178557-14178579 GCTGCACTATTCACACGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154416528 Original CRISPR CCCAACCCGCTCCCCACGAT GGG (reversed) Intergenic
No off target data available for this crispr