ID: 1154423166

View in Genome Browser
Species Human (GRCh38)
Location 18:14252332-14252354
Sequence CACCCAGGACAACCCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154423159_1154423166 23 Left 1154423159 18:14252286-14252308 CCTCGCAGCAATTCCATTCTGCA No data
Right 1154423166 18:14252332-14252354 CACCCAGGACAACCCCATCAGGG No data
1154423160_1154423166 10 Left 1154423160 18:14252299-14252321 CCATTCTGCATCTTTTCTCATCA No data
Right 1154423166 18:14252332-14252354 CACCCAGGACAACCCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154423166 Original CRISPR CACCCAGGACAACCCCATCA GGG Intergenic
No off target data available for this crispr