ID: 1154427530

View in Genome Browser
Species Human (GRCh38)
Location 18:14283655-14283677
Sequence CTGTAGCTTTTCAACACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154427530_1154427533 -8 Left 1154427530 18:14283655-14283677 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154427533 18:14283670-14283692 AGCTACAGGCATTCAACACCAGG No data
1154427530_1154427537 15 Left 1154427530 18:14283655-14283677 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154427537 18:14283693-14283715 CTAGCCAATGAGGGCAGCTGTGG No data
1154427530_1154427538 16 Left 1154427530 18:14283655-14283677 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154427538 18:14283694-14283716 TAGCCAATGAGGGCAGCTGTGGG No data
1154427530_1154427535 6 Left 1154427530 18:14283655-14283677 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154427535 18:14283684-14283706 AACACCAGGCTAGCCAATGAGGG No data
1154427530_1154427540 18 Left 1154427530 18:14283655-14283677 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154427540 18:14283696-14283718 GCCAATGAGGGCAGCTGTGGGGG No data
1154427530_1154427534 5 Left 1154427530 18:14283655-14283677 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154427534 18:14283683-14283705 CAACACCAGGCTAGCCAATGAGG No data
1154427530_1154427539 17 Left 1154427530 18:14283655-14283677 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154427539 18:14283695-14283717 AGCCAATGAGGGCAGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154427530 Original CRISPR CTGTAGCTTTTCAACACTGA GGG (reversed) Intergenic
No off target data available for this crispr