ID: 1154428511

View in Genome Browser
Species Human (GRCh38)
Location 18:14290565-14290587
Sequence CTACAATTCCACATGAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154428511_1154428516 -3 Left 1154428511 18:14290565-14290587 CCAATATTCATGTGGAATTGTAG No data
Right 1154428516 18:14290585-14290607 TAGTAGGGAATGTTAAAGGTGGG No data
1154428511_1154428522 24 Left 1154428511 18:14290565-14290587 CCAATATTCATGTGGAATTGTAG No data
Right 1154428522 18:14290612-14290634 GGTGGGAGGTGATTTAATCACGG No data
1154428511_1154428518 6 Left 1154428511 18:14290565-14290587 CCAATATTCATGTGGAATTGTAG No data
Right 1154428518 18:14290594-14290616 ATGTTAAAGGTGGGACCTGGTGG No data
1154428511_1154428517 3 Left 1154428511 18:14290565-14290587 CCAATATTCATGTGGAATTGTAG No data
Right 1154428517 18:14290591-14290613 GGAATGTTAAAGGTGGGACCTGG No data
1154428511_1154428520 10 Left 1154428511 18:14290565-14290587 CCAATATTCATGTGGAATTGTAG No data
Right 1154428520 18:14290598-14290620 TAAAGGTGGGACCTGGTGGGAGG No data
1154428511_1154428515 -4 Left 1154428511 18:14290565-14290587 CCAATATTCATGTGGAATTGTAG No data
Right 1154428515 18:14290584-14290606 GTAGTAGGGAATGTTAAAGGTGG No data
1154428511_1154428514 -7 Left 1154428511 18:14290565-14290587 CCAATATTCATGTGGAATTGTAG No data
Right 1154428514 18:14290581-14290603 ATTGTAGTAGGGAATGTTAAAGG No data
1154428511_1154428519 7 Left 1154428511 18:14290565-14290587 CCAATATTCATGTGGAATTGTAG No data
Right 1154428519 18:14290595-14290617 TGTTAAAGGTGGGACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154428511 Original CRISPR CTACAATTCCACATGAATAT TGG (reversed) Intergenic
No off target data available for this crispr